Anoplius virginiensis

(Cresson, 1867) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Anoplius

At a glance

Occurrence records336

Data sources6

Biological traits0

DNA specimens103

eDNA detections107

Sources6 archives

Databases and archives Anoplius virginiensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics103 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF336 records

Environmental DNA1 datasets · 2 countries107 detections

DNA & barcodingBOLD103 specimens

01Narrative

Anoplius virginiensis is a species of spider wasp in the family Pompilidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding103 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplius virginiensis has left across the world's sequence archives.

At a glance

DNA specimens103

BINs1

Marker genes1

eDNA detections107

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 87 variable positions, in barcode order

331Gmostly conserved

343Tmostly conserved

485Amostly conserved

486Amostly conserved

488Amostly conserved

489Tmostly conserved

491Tmostly conserved

493Tmostly conserved

494Tmostly conserved

496Amostly conserved

498Tmostly conserved

501Gmostly conserved

502Tmostly conserved

504Gmostly conserved

505Gmostly conserved

507Cmostly conserved

508Amostly conserved

509Gmostly conserved

510Tmostly conserved

511Tmostly conserved

513Tmostly conserved

514Gmostly conserved

517Amostly conserved

518Amostly conserved

519Cmostly conserved

520Amostly conserved

522Cmostly conserved

523Tmostly conserved

524Tmostly conserved

525Tmostly conserved

526Tmostly conserved

527Cmostly conserved

528Tmostly conserved

532Amostly conserved

535Amostly conserved

539Tmostly conserved

540Cmostly conserved

545Cmostly conserved

548Gmostly conserved

551Tmostly conserved

552Tmostly conserved

553Gmostly conserved

555Cmostly conserved

556Tmostly conserved

557Gmostly conserved

558Gmostly conserved

562Amostly conserved

563Amostly conserved

564Tmostly conserved

565Tmostly conserved

566Amostly conserved

571Amostly conserved

572Tmostly conserved

573Tmostly conserved

575Tmostly conserved

578Gmostly conserved

579Cmostly conserved

581Gmostly conserved

582Amostly conserved

583Tmostly conserved

584Cmostly conserved

585Gmostly conserved

587Amostly conserved

590Tmostly conserved

591Tmostly conserved

592Tmostly conserved

597Cmostly conserved

599Tmostly conserved

600Cmostly conserved

603Tmostly conserved

606Tmostly conserved

608Gmostly conserved

611Cmostly conserved

612Cmostly conserved

614Amostly conserved

617Gmostly conserved

618Gmostly conserved

619Amostly conserved

620Gmostly conserved

621Gmostly conserved

622Amostly conserved

625Gmostly conserved

627Amostly conserved

628Tmostly conserved

629Cmostly conserved

630Cmostly conserved

631Tmostly conserved

TACCTTATATTTTATATTTGGGATATGATCAGGGGCTTTAGGCACTTCATTAAGAATATTAATTCGTATTGAATTAGGGAGGCCTGGTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes10

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplius nigerrimussame genus8.9%Anoplius ventralissame genus9.7%Anoplius tenuicornissame genus9.9%Anoplius insolenssame genus10.0%Anoplius alpinobalticussame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type336 records

Wild obs. + sensor1

Museum / vouchered335

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 4≤10 km 16>10 km 1

21 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence335

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	95
Cleveland Museum of Natural History, OH (CLEV)location not on record	86
OSUClocation not on record	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	22
US	19
Champaign, US	13
University of Central Floridalocation not on record	12
Cambridge, US	8
WIlocation not on record	3
Universidad Católica de Manizaleslocation not on record	3
Chicago, US	3

11 institutions · 298 of 335 vouchered records shown · 37 without an institution code

09Environmental DNA107 detections

Where the DNA of Anoplius virginiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestAgriculturalForestUrbanRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 15.2–21.6

Seasonal swing summer↔winter26.6 °C

Max temp (day)22.8 °C 19.8–25.5

Min temp (night)15.4 °C 12.2–18.2

Precipitation91.2 mm/mo 79.3–107

Air humidity58.9 % 57.7–62.8

Moisture balance-50.0 mm/mo -74.6–-11.5

Vapour deficit855 Pa 686–1,067

Wind speed2.80 m/s 2.30–4.10

Cloud cover41.1 % 37.6–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 100 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)