Anoplius imbellis

Banks, 1944 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Anoplius

At a glance

Occurrence records126

Data sources5

Biological traits0

DNA specimens20

eDNA detections4

Sources5 archives

Databases and archives Anoplius imbellis's data was compiled from.

GBIFGlobal Biodiversity Information Facility126 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF126 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD20 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplius imbellis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P628 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.76%

Haplotypes0

BIN1

Where individuals differ — all 13 variable positions, in barcode order

115Gmostly conserved

196Cvariable

211Tvariable

298Avariable

319Cmostly conserved

349Gvariable

391Avariable

410Gmostly conserved

439Gvariable

484Gvariable

547Gvariable

594Nhighly variable

604Nhighly variable

GTGATCTGGGGCTTTAGGTACTTCATTAAGAATATTAATTCGAATTGAATTAGGGAGTCCTGGACAGGTTTTAGGTAATGATCAAATTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplius alpinobalticussame genus8.9%Anoplius illinoensissame genus9.4%Anoplius nigerrimussame genus10.0%Anoplius tolucasame genus10.4%Anoplius ventralissame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type126 records

Museum / vouchered126

Range

Area of Occupancy AOO208 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 1≤1 km 11≤10 km 7>10 km 7

26 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence126

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	35
University of Guelphlocation not on record	35
Santa Cruz, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Cambridge, US	6
WIlocation not on record	5
University of Central Floridalocation not on record	4
University of Alabamalocation not on record	4
Royal British Columbia Museumlocation not on record	3
Universidad Católica de Manizaleslocation not on record	2
Champaign, US	2
Edmonton, CA	2
College Station, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
OSUClocation not on record	1
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	1
Anchorage, US	1
Ciudad de México, MX	1

18 institutions · 119 of 126 vouchered records shown · 7 without an institution code

09Environmental DNA4 detections

Where the DNA of Anoplius imbellis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.9–17.0

Seasonal swing summer↔winter8.50 °C

Max temp (day)17.5 °C 17.5–23.1

Min temp (night)13.5 °C 12.0–13.5

Precipitation23.7 mm/mo 23.7–26.5

Air humidity60.6 % 54.2–60.6

Vapour deficit664 Pa 664–901

Cloud cover32.6 % 32.6–34.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)