Anopheles punctipennis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records56 327

Data sources9

Biological traits0

DNA specimens449

eDNA detections479

Sources9 archives

Databases and archives Anopheles punctipennis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 327 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI479 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics449 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF56 327 records

Environmental DNA1 datasets · 2 countries479 detections

DNA & barcodingBOLD449 specimens

Genome at a glanceGoaT · TreeOfSex2n = 6

01Narrative

Anopheles punctipennis is a species of mosquito in genus Anopheles. It is native to North America.Anopheles punctipennis. Walter Reed Biosystematics Unit, Walter Reed Army Institute of Research. The larvae of this species can be found many kinds of natural and artificial water bodies, especially cool, clear waters such as streams. Females feed on blood, including the blood of humans, and may bite during the day or night. They generally stay outdoors and are rarely found inside dwellings. This species is a vector of P. vivax, one of the protozoans that cause malaria.Jensen, T., et al. (1998). Lake Vera revisited: parity and survival rates of Anopheles punctipennis at the site of a malaria outbreak in the Sierra Nevada foothills of California. The American Journal of Tropical Medicine and Hygiene, 59(4), 591-594.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding449 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles punctipennis has left across the world's sequence archives.

At a glance

DNA specimens449

BINs3

Marker genes3

eDNA detections479

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus438 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

40Amostly conserved

43Gmostly conserved

79Amostly conserved

88Amostly conserved

103Cmostly conserved

181Gmostly conserved

229Gmostly conserved

271Tmostly conserved

280Gmostly conserved

316Amostly conserved

343Tmostly conserved

373Amostly conserved

433Gmostly conserved

475Cmostly conserved

565Amostly conserved

625Amostly conserved

631Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGGACTTCTTTAAGTATTCTAATTCGTGCTGAATTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 30 commonest of 311 variants.

Diversity (π)1.1%

Haplotypes311

BINs3

Most divergent pair17.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles beklemishevisame genus5.9%Anopheles labranchiaesame genus6.2%Anopheles daciaesame genus6.4%Anopheles messeaesame genus6.4%Anopheles earleisame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anopheles punctipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 67×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Kitzmiller, J. B. (1963). "Mosquito Cytogenetics: A Review of the Literature, 1953-62." Bulletin of the World Health Organization 29(3): 345. ↗

TreeOfSex · invert — Makino, S. (1951). An atlas of the chromosome numbers in Animals. Ames, Iowa, Iowa State College Press. ↗

08Occurrence & distribution

Record type56 327 records

Wild obs. + sensor53 371

Museum / vouchered2 955

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO8 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 560≤1 km 126≤10 km 39>10 km 156

881 georeferenced · 52 490 without coordinates

Open the mapobservation + sensor53 371

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1 919≤1 km 72≤10 km 354>10 km 55

2 400 georeferenced · 555 without coordinates

Open the institutions mapphysical evidence2 955

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 492
Ciudad de México, MX	278
Champaign, US	192
East Lansing, US	171
San Nicolás de los Garza, MX	98
Wuzhou, CN	91
San Francisco, US	88
Saint John, CA	82
CUlocation not on record	75
Ann Arbor, US	59
Cambridge, US	59
UNHClocation not on record	43
Chicago, US	40
New Haven, US	35
Secretaría de Salud de Guanajuatolocation not on record	19
Vancouver, CA	7
St. Paul, US	6
Cornell University Insect Collectionlocation not on record	5
Edmonton, CA	5
Centro Regional de Investigación en Salud Pública, Instituto Nacional de Salud Públicalocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
NEON Biorepository at Arizona State Universitylocation not on record	3
National Ecological Observatory Network, United Stateslocation not on record	3
Albuquerque, US	2
University of Guelphlocation not on record	2
Chicago, US	2
Los Angeles, US	1
Centre for Biodiversity Genomicslocation not on record	1
University Park, US	1
Torreón, MX	1
Philadelphia, US	1
Tartu, EE	1

32 institutions · 2 871 of 2 955 vouchered records shown · 83 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA479 detections

Where the DNA of Anopheles punctipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found479

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 479 detections have coordinates

Open the map2 countries0

deciduousForestwoodyWetlandsmixedForestshrubScrubForestPond

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 10.0–23.2

Seasonal swing summer↔winter23.6 °C

Max temp (day)23.7 °C 15.2–28.5

Min temp (night)14.2 °C 5.60–19.0

Precipitation103 mm/mo 81.2–125

Air humidity58.0 % 55.8–60.7

Moisture balance-15.4 mm/mo -58.3–40.9

Vapour deficit890 Pa 565–1,198

Wind speed2.90 m/s 2.10–4.20

Cloud cover38.6 % 31.4–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 350 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles punctipennis

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type56 327 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type56 327 records