Anopheles earlei

Vargas, 1943 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records692

Data sources7

Biological traits0

DNA specimens22

eDNA detections37

Sources7 archives

Databases and archives Anopheles earlei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility692 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF692 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD22 specimens

01Narrative

Anopheles earlei is a small insect found throughout North America. The Anopheles earlei larvae are found in cold, clear water in ponds and other small bodies of water that contain plant life or vegetation.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles earlei has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections37

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

4Tmostly conserved

5Tmostly conserved

10Cmostly conserved

286Amostly conserved

343Tvariable

373Amostly conserved

433Avariable

535Amostly conserved

607Amostly conserved

613Cmostly conserved

622Tmostly conserved

628Gmostly conserved

631Amostly conserved

646Cmostly conserved

658Tmostly conserved

AACTTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGTGCTGAATTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes7

BINs2

Most divergent pair6.8%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles messeaesame genus3.8%Anopheles daciaesame genus3.8%Anopheles maculipennissame genus4.0%Anopheles beklemishevisame genus4.3%Anopheles melanoonsame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type692 records

Wild obs. + sensor501

Museum / vouchered191

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 16≤1 km 3>10 km 1

20 georeferenced · 481 without coordinates

Open the mapobservation + sensor501

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 44≤1 km 7≤10 km 53>10 km 9

113 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	45
Tempe, US	41
Saint John, CA	24
Vancouver, CA	16
East Lansing, US	12
Royal Saskatchewan Museumlocation not on record	10
WIlocation not on record	8
Mosquitolocation not on record	7
UNHClocation not on record	6
St. Paul, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
University of Guelphlocation not on record	3
Wuzhou, CN	1
Cornell University Insect Collectionlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Washington, US	1

16 institutions · 185 of 191 vouchered records shown · 6 without an institution code

09Environmental DNA37 detections

Where the DNA of Anopheles earlei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

Wetland1.1 Boreal Forest4. Native Grassland | 4.4. Temperate GrasslandPonddeciduousForestshrubScrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C -2.10–19.4

Seasonal swing summer↔winter29.9 °C

Max temp (day)20.9 °C 2.10–22.4

Min temp (night)9.20 °C -5.60–18.2

Precipitation59.2 mm/mo 33.9–104

Air humidity58.4 % 52.7–61.9

Moisture balance-49.7 mm/mo -115–3.40

Vapour deficit766 Pa 331–857

Wind speed2.70 m/s 0.9–5.30

Cloud cover43.0 % 34.8–64.1

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)