Anopheles messeae

Falleroni, 1926 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records1 100

Data sources5

Biological traits2

DNA specimens348

eDNA detections94

Sources5 archives

Databases and archives Anopheles messeae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI94 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics348 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 100 records

Environmental DNA1 datasets · 7 countries94 detections

DNA & barcodingBOLD348 specimens

01Narrative

Anopheles messeae ist eine Art der Malariamücken (Anopheles), die zur Anopheles-maculipennis-Gruppe gezählt wird. Sie ist in Mittel- und Osteuropa weit verbreitet, besonders häufig ist sie in Norditalien, auf dem Balkan, am Schwarzen Meer und im Norden und Osten Russlands. Die Art kommt typischerweise im Binnenland vor, insbesondere in Flusstälern und anderen gewässerreichen Gebieten. An der Küste ist Anopheles messeae selten zu finden, hier überwiegt Anopheles atroparvus. Anopheles messeae ist üblicherweise in der Abenddämmerung aktiv. Die Eier werden von Anopheles messeae bevorzugt in größeren, flachen und am Rand gut bewachsenen Gewässern abgelegt. Man findet die Larven in den Altwässern von Flüssen, in Gräben und am schilfbewachsenen Ufer von Seen und Teichen. Die Weibchen überwintern in ungeheizten Räumen, im Frühjahr legen sie nach der Aufnahme von Blut ihre Eier ab. Zwischen Mitte und Ende Mai erscheinen die Mücken der neuen Generation. In den Donauländern und Russland war Anopheles messeae ein wichtiger Malariavektor. In Deutschland galt sie lange Zeit als unbedeutender Malariaüberträger. Beim Wiederaufflackern der Malaria nach dem Zweiten Weltkrieg war diese Stechmückenart jedoch der wichtigste Überträger. Vermutlich war sie auch in den vergangenen Jahrhunderten in vielen Fällen für die Malariaübertragung im Binnenland verantwortlich.Heinz-Werner Baer: Anopheles und Malaria in Thüringen, VEB Gustav Fischer, Jena, 1960Walter Reed Biosystematics Unit: Systematic Catalog of the Culicidae, Anopheles messeae

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding348 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles messeae has left across the world's sequence archives.

At a glance

DNA specimens348

BINs1

Marker genes5

eDNA detections94

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus201 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

55Tmostly conserved

85Cmostly conserved

133Amostly conserved

169Amostly conserved

172Cmostly conserved

181Gmostly conserved

184Tmostly conserved

187Cmostly conserved

223Tmostly conserved

226Gvariable

280Gmostly conserved

292Tmostly conserved

310Amostly conserved

319Cmostly conserved

325Gvariable

355Amostly conserved

418Amostly conserved

424Tmostly conserved

445Amostly conserved

460Amostly conserved

529Amostly conserved

568Tmostly conserved

580Amostly conserved

610Tmostly conserved

ATTAAGTATTTTAATTCGTGCTGAATTAGGACACCCTGGAGCTTTTATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCCCATGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 105 variants.

Diversity (π)1.2%

Haplotypes105

BIN1

Most divergent pair3.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles labranchiaesame genus2.3%Anopheles maculipennissame genus2.6%Anopheles melanoonsame genus3.1%Anopheles atroparvussame genus3.3%Anopheles beklemishevisame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S18S-3P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type1 100 records

Wild obs. + sensor701

Museum / vouchered399

Range

Area of Occupancy AOO2 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 51≤1 km 14≤10 km 7

72 georeferenced · 629 without coordinates

Open the mapobservation + sensor701

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 13≤1 km 1

14 georeferenced · 385 without coordinates

Open the institutions mapphysical evidence399

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BMNHlocation not on record	127
University of Helsinkilocation not on record	30
Naturalis Biodiversity Centerlocation not on record	5
Animal and Plant Health Agency, UKlocation not on record	4
Tartu, EE	3
University of Queensland Insect Collectionlocation not on record	2
South Kensington, GB	2
Mohonk Preserve, Inc.location not on record	1
RKlocation not on record	1
Provincia di Ascoli Picenolocation not on record	1

10 institutions · 176 of 399 vouchered records shown · 204 without an institution code

09Environmental DNA94 detections

Where the DNA of Anopheles messeae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found94

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 94 detections have coordinates

Open the map7 countries0

Agricultural ditchPlas-drasFarmyard/ RoadsideCultivated FieldScrub/ LakesideHouse by scrub & lake

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 10.1–18.0

Seasonal swing summer↔winter20.1 °C

Max temp (day)18.9 °C 11.8–21.3

Min temp (night)13.2 °C 6.50–15.5

Precipitation72.2 mm/mo 36.6–88.9

Air humidity60.2 % 55.8–63.1

Moisture balance-38.5 mm/mo -67.0–16.6

Vapour deficit766 Pa 489–872

Wind speed3.60 m/s 2.60–5.60

Cloud cover43.7 % 37.9–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles messeae

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type1 100 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 100 records