Anopheles maculipennis

Meigen, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records2 511

Data sources9

Biological traits0

DNA specimens251

eDNA detections199

Sources9 archives

Databases and archives Anopheles maculipennis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI199 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics251 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 511 records

Environmental DNA1 datasets · 5 countries199 detections

DNA & barcodingBOLD251 specimens

Genome at a glanceGoaT · TreeOfSex2n = 6

01Narrative

Anopheles maculipennis is a species of mosquito that can be found mostly in Europe except New Zealand; it is a main vector of malaria.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding251 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles maculipennis has left across the world's sequence archives.

At a glance

DNA specimens251

BINs2

Marker genes4

eDNA detections199

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus153 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

49Tvariable

79Amostly conserved

100Avariable

133Tmostly conserved

214Amostly conserved

232Tvariable

271Tmostly conserved

289Gmostly conserved

313Cvariable

316Amostly conserved

328Avariable

352Cvariable

373Gmostly conserved

400Avariable

415Gvariable

433Avariable

439Gvariable

478Gvariable

508Amostly conserved

589Cvariable

616Cmostly conserved

625Avariable

631Avariable

634Cvariable

AACTTTATATTTTATTTTCGGAGCTTGAGCAGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGTGCTGAATTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 52 variants.

Diversity (π)1.7%

Haplotypes52

BINs2

Most divergent pair3.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles melanoonsame genus2.0%Anopheles labranchiaesame genus2.3%Anopheles daciaesame genus2.4%Anopheles messeaesame genus2.6%Anopheles atroparvussame genus2.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anopheles maculipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Kitzmiller, J. B. (1963). "Mosquito Cytogenetics: A Review of the Literature, 1953-62." Bulletin of the World Health Organization 29(3): 345. ↗

08Occurrence & distribution

Record type2 511 records

Wild obs. + sensor1 107

Museum / vouchered1 403

Other1

Origin

Native1

Range

Area of Occupancy AOO3 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 150≤1 km 7≤10 km 184

341 georeferenced · 766 without coordinates

Open the mapobservation + sensor1 107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 27≤1 km 41≤10 km 28>10 km 65

161 georeferenced · 1 242 without coordinates

Open the institutions mapphysical evidence1 403

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BMNHlocation not on record	580
Animal and Plant Health Agency, UKlocation not on record	113
Istituto Zooprofilattico Sperimentale della Lombardia e dell'Emilia-Romagnalocation not on record	103
San Francisco, US	61
Brussels, BE	59
Tartu, EE	20
Helsinki, FI	14
Champaign, US	13
University of Helsinkilocation not on record	13
ITGlocation not on record	8
Ciudad de México, MX	8
WIlocation not on record	6
East Lansing, US	5
University of Osijeklocation not on record	5
MZLUlocation not on record	4
Trondheim, NO	3
South Kensington, GB	2
Naturalis Biodiversity Centerlocation not on record	1
SLU Artdatabankenlocation not on record	1
Auckland, NZ	1
Natural History Museum Rotterdamlocation not on record	1
Natural History Museum, Londonlocation not on record	1
RKlocation not on record	1

23 institutions · 1 023 of 1 403 vouchered records shown · 378 without an institution code

09Environmental DNA199 detections

Where the DNA of Anopheles maculipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found199

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 199 detections have coordinates

Open the map5 countries0

Coniferous Woodland/ RoadsideRoadside (grassy verge)Cultivated FieldCultivated Field/ RoadsideIn toilet cabinSuburbs: Open, grassy area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 14.9–25.4

Seasonal swing summer↔winter22.1 °C

Max temp (day)28.4 °C 18.8–30.2

Min temp (night)18.2 °C 10.8–19.4

Precipitation69.9 mm/mo 49.7–86.8

Air humidity54.3 % 52.8–60.2

Moisture balance-84.2 mm/mo -127–-0.4

Vapour deficit1,340 Pa 716–1,527

Wind speed2.10 m/s 1.50–2.80

Cloud cover38.0 % 35.7–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 127 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles maculipennis

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 511 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 511 records