Anomala corpulenta

Motschulsky, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Anomala

At a glance

Occurrence records141

Data sources6

Biological traits0

DNA specimens14

eDNA detections11

Sources6 archives

Databases and archives Anomala corpulenta's data was compiled from.

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomala corpulenta has left across the world's sequence archives.

At a glance

DNA specimens14

BINs3

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

46Tmostly conserved

49Tmostly conserved

85Cvariable

106Tvariable

115Tmostly conserved

118Cmostly conserved

133Tmostly conserved

136Tmostly conserved

142Cmostly conserved

148Amostly conserved

154Cvariable

172Cmostly conserved

181Amostly conserved

184Tmostly conserved

190Tvariable

196Amostly conserved

199Amostly conserved

205Cmostly conserved

206Tmostly conserved

208Amostly conserved

212Tmostly conserved

220Tmostly conserved

241Tmostly conserved

259Tmostly conserved

266Cmostly conserved

274Tmostly conserved

277Cvariable

283Avariable

284Cmostly conserved

290Tvariable

301Amostly conserved

325Cmostly conserved

328Cmostly conserved

337Tmostly conserved

349Cmostly conserved

364Cmostly conserved

373Amostly conserved

394Tmostly conserved

397Cmostly conserved

400Amostly conserved

412Tmostly conserved

418Tmostly conserved

421Cvariable

424Amostly conserved

439Cmostly conserved

475Amostly conserved

490Cmostly conserved

499Tvariable

517Tmostly conserved

520Amostly conserved

523Amostly conserved

526Amostly conserved

539Tmostly conserved

547Cvariable

548Cmostly conserved

550Cvariable

553Amostly conserved

556Amostly conserved

562Amostly conserved

571Cvariable

574Tmostly conserved

583Cmostly conserved

589Tmostly conserved

597Tmostly conserved

601Tmostly conserved

607Tmostly conserved

610Tvariable

616Tmostly conserved

619Cmostly conserved

622Amostly conserved

628Tmostly conserved

634Tmostly conserved

637Tmostly conserved

653Cmostly conserved

AACTTTATATTTCCTATTCGGCAGATGGGCCGGAATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes4

BINs3

Most divergent pair10.3%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomala dubiasame genus8.7%Anomala vitissame genus8.8%Anomala luculentasame genus10.2%Anomala rufocupreasame genus10.3%Anomala cupreasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_069575 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anomala corpulenta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Yadav JS, Pillai RK, Karamjeet (1979) Chromosome Numbers of Scarabaeidae (Polyphaga: Coleoptera). Coleopt Bull 33: 309-318. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type141 records

Wild obs. + sensor117

Museum / vouchered24

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 26≤1 km 9≤10 km 2>10 km 13

50 georeferenced · 67 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	14
University Park, US	3

2 institutions · 17 of 24 vouchered records shown · 4 without an institution code

09Environmental DNA11 detections

Where the DNA of Anomala corpulenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–17.2

Seasonal swing summer↔winter28.4 °C

Max temp (day)21.2 °C 21.2–22.0

Min temp (night)10.1 °C 10.1–11.4

Precipitation33.3 mm/mo 33.3–79.0

Air humidity52.2 % 52.2–54.8

Moisture balance-52.9 mm/mo -52.9–-42.5

Vapour deficit836 Pa 836–887

Wind speed3.40 m/s 3.10–3.40

Cloud cover22.4 % 22.4–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)