Anomala rufocuprea

Motschulsky, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Anomala

At a glance

Occurrence records598

Data sources6

Biological traits0

DNA specimens5

eDNA detections1

Sources6 archives

Databases and archives Anomala rufocuprea's data was compiled from.

GBIFGlobal Biodiversity Information Facility598 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF598 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomala rufocuprea has left across the world's sequence archives.

At a glance

DNA specimens5

BINs3

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)3.4%

Haplotypes2

BINs3

Most divergent pair4.7%

Where individuals differ — all 46 variable positions, in barcode order

67Amostly conserved

85Avariable

94Gvariable

112Cmostly conserved

133Avariable

145Tmostly conserved

181Amostly conserved

196Amostly conserved

205Cmostly conserved

217Avariable

229Gvariable

247Tvariable

262Gmostly conserved

265Tmostly conserved

266Tmostly conserved

274Cmostly conserved

319Cmostly conserved

328Tvariable

364Cvariable

397Tmostly conserved

400Tvariable

406Tvariable

412Tvariable

418Tvariable

421Avariable

463Tmostly conserved

478Tmostly conserved

490Cmostly conserved

493Tvariable

499Amostly conserved

520Amostly conserved

529Tvariable

530Cmostly conserved

532Amostly conserved

536Tmostly conserved

539Tmostly conserved

553Amostly conserved

574Cvariable

589Tvariable

598Cvariable

607Amostly conserved

622Gmostly conserved

625Amostly conserved

628Tmostly conserved

634Tmostly conserved

646Cmostly conserved

AACTTTATACTTCCTATTCGGCAGATGGGCCGGAATAGTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomala koreanasame genus6.7%Anomala chamaeleonsame genus6.8%Anomala dubiasame genus8.5%Anomala viridanasame genus8.6%Anomala dimidiatasame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anomala rufocuprea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–202n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Yadav JS, Pillai RK, Karamjeet (1979) Chromosome Numbers of Scarabaeidae (Polyphaga: Coleoptera). Coleopt Bull 33: 309-318. ↗

2n 202×GoaT · Animal Chromosome Counts Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type598 records

Wild obs. + sensor205

Museum / vouchered393

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 9≤1 km 3≤10 km 2>10 km 8

22 georeferenced · 183 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 393 records without

Open the institutions mapphysical evidence393

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	131
Sam Noble Oklahoma Museum of Natural Historylocation not on record	59
Iwate Prefectural Museumlocation not on record	27
Bando, JP	26
Sagamihara, JP	22
Yamaguchi-shi, JP	21
Nagatoro-machi, Chichibu-gun, JP	20
KOMlocation not on record	19
RCMlocation not on record	19
Toyota city nature sanctuarylocation not on record	12
Tomioka, JP	11
Toyama, JP	7
Sanda, JP	7
KCMNlocation not on record	6
Tokushima, JP	3
Corporación Colombiana de Investigación Agropecuaria - AGROSAVIAlocation not on record	1
KNAMlocation not on record	1

17 institutions · 392 of 393 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Anomala rufocuprea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)