Anomala cuprea

(Hope, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Anomala

At a glance

Occurrence records404

Data sources7

Biological traits0

DNA specimens34

eDNA detections2

Sources7 archives

Databases and archives Anomala cuprea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility404 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF404 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT2n = 20

01Narrative

ドウガネブイブイは、甲虫目コガネムシ科の草食昆虫。

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Anomala cuprea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Lupane triterpenoids2

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3aS,5aR,5bR,7aR,9R,11aR,11bS,13aR,13bR)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
Epibetulinic Acid	present	NPASS
FVWJYYTZTCVBKE-HOSPYWTJSA-N	present	NPASS

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomala cuprea has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P605 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

9Cmostly conserved

37Tmostly conserved

54Amostly conserved

72Tmostly conserved

78Tmostly conserved

81Amostly conserved

105Cmostly conserved

117Amostly conserved

126Tmostly conserved

135Amostly conserved

144Cmostly conserved

147Amostly conserved

150Amostly conserved

153Amostly conserved

165Tmostly conserved

168Amostly conserved

174Tmostly conserved

210Cmostly conserved

222Tmostly conserved

225Tmostly conserved

234Cmostly conserved

249Amostly conserved

261Cmostly conserved

264Tmostly conserved

276Cmostly conserved

300Cmostly conserved

303Cmostly conserved

324Amostly conserved

333Gvariable

342Cmostly conserved

387Cmostly conserved

399Tmostly conserved

402Amostly conserved

450Tmostly conserved

453Amostly conserved

462Tmostly conserved

474Cmostly conserved

486Tmostly conserved

495Gmostly conserved

504Avariable

507Gmostly conserved

508Cmostly conserved

522Tmostly conserved

526Tmostly conserved

537Tmostly conserved

552Tmostly conserved

594Cmostly conserved

CTATTCGGCAGATGGGCCGGAATAGTAGGAACTTCTTTAAGACTACTAATTCGAGCAGAATTAGGAAACCCTGGATCTCTAATTGGTGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes19

BINs3

Most divergent pair9.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomala mongolicasame genus5.5%Anomala viridanasame genus5.6%Anomala rufocupreasame genus9.6%Mimela splendenssame family10.6%Anomala dubiasame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anomala cuprea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×GoaT · Animal Chromosome Counts Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type404 records

Wild obs. + sensor135

Museum / vouchered269

Range

Area of Occupancy AOO916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 53≤1 km 8≤10 km 5>10 km 26

92 georeferenced · 43 without coordinates

Open the mapobservation + sensor135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 8>10 km 1

9 georeferenced · 260 without coordinates

Open the institutions mapphysical evidence269

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	66
Nagatoro-machi, Chichibu-gun, JP	41
Bando, JP	27
Sanda, JP	27
Tomioka, JP	12
Iwate Prefectural Museumlocation not on record	10
RCMlocation not on record	9
Amur Branch of Botanical Garden-Institute of the Far East Branch of the Russian Academy of Scienceslocation not on record	8
Sam Noble Oklahoma Museum of Natural Historylocation not on record	7
Yamaguchi-shi, JP	7
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	7
Sagamihara, JP	6
KCMNlocation not on record	3
Toyota city nature sanctuarylocation not on record	2
DPIlocation not on record	2
Cape Town, ZA	1
Saga Prefectural Space and Science Museumlocation not on record	1
KOMlocation not on record	1
University Park, US	1

19 institutions · 238 of 269 vouchered records shown · 30 without an institution code

09Environmental DNA2 detections

Where the DNA of Anomala cuprea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.3 °C 15.7–18.9

Seasonal swing summer↔winter25.4 °C

Max temp (day)19.5 °C 18.1–20.9

Min temp (night)13.2 °C 11.4–14.9

Precipitation404 mm/mo 357–451

Air humidity64.8 % 64.0–65.5

Moisture balance271 mm/mo 228–314

Vapour deficit699 Pa 643–755

Wind speed2.50 m/s 2.40–2.50

Cloud cover50.0 % 49.5–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)