Anisodactylus rusticus

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records2 537

Data sources6

Biological traits0

DNA specimens207

eDNA detections202

Sources6 archives

Databases and archives Anisodactylus rusticus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 537 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI202 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics207 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 537 records

Environmental DNA1 datasets · 2 countries202 detections

DNA & barcodingBOLD207 specimens

01Narrative

Anisodactylus rusticus is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding207 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus rusticus has left across the world's sequence archives.

At a glance

DNA specimens207

BINs5

Marker genes2

eDNA detections202

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus196 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

61Gmostly conserved

205Gmostly conserved

229Gmostly conserved

271Tmostly conserved

289Cmostly conserved

316Amostly conserved

322Gmostly conserved

340Tmostly conserved

346Cmostly conserved

367Cvariable

484Tmostly conserved

493Gvariable

536Cmostly conserved

595Cmostly conserved

616Tmostly conserved

625Amostly conserved

628Amostly conserved

634Cmostly conserved

646Cmostly conserved

AACTTTATATTTCATCTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTGATTCGAGCTGAATTAGGAACTCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 107 variants.

Diversity (π)1.1%

Haplotypes107

BINs5

Most divergent pair7.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus merulasame genus1.8%Anisodactylus laetussame genus6.2%Anisodactylus opaculussame genus6.2%Anisodactylus haplomussame genus6.7%Anisodactylus dulcicollissame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type2 537 records

Wild obs. + sensor300

Museum / vouchered2 237

Range

Area of Occupancy AOO1 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 173≤1 km 36≤10 km 10>10 km 25

244 georeferenced · 56 without coordinates

Open the mapobservation + sensor300

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 1 558≤1 km 17≤10 km 219>10 km 51

1 845 georeferenced · 392 without coordinates

Open the institutions mapphysical evidence2 237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	1 635
Essig Museum of Entomologylocation not on record	71
Mississippi State, US	66
Espace pour la vielocation not on record	63
Decorah, US	56
University Park, US	54
Colorado State Universitylocation not on record	42
University of Alberta Museums (UAM)location not on record	40
OSUClocation not on record	24
Lexington, US	24
Sam Noble Oklahoma Museum of Natural Historylocation not on record	19
University of Alabamalocation not on record	13
Provo, US	12
Cambridge, US	10
College Station, US	7
NEON Biorepository at Arizona State Universitylocation not on record	7
Chicago, US	6
Lubbock, US	6
UDlocation not on record	5
Champaign, US	4
CUlocation not on record	4
Saint John, CA	3
EWIClocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Canadian Centre for DNA Barcodinglocation not on record	2
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
WIlocation not on record	1
New Haven, US	1

30 institutions · 2 184 of 2 237 vouchered records shown · 53 without an institution code

09Environmental DNA202 detections

Where the DNA of Anisodactylus rusticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found202

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 202 detections have coordinates

Open the map2 countries0

Mixed habitatCorn14. Artificial - Terrestrial | 14.2 Pasturel…deciduousForestshrubScrubpastureHay

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 14.2–25.4

Seasonal swing summer↔winter24.1 °C

Max temp (day)27.6 °C 20.2–31.0

Min temp (night)17.0 °C 8.20–21.8

Precipitation94.5 mm/mo 63.5–117

Air humidity56.5 % 50.6–59.2

Moisture balance-69.7 mm/mo -122–-22.5

Vapour deficit1,149 Pa 758–1,415

Wind speed3.80 m/s 2.60–4.80

Cloud cover31.7 % 22.0–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 201 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anisodactylus rusticus

At a glance

Sources6 archives

At a glance

Record type2 537 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 537 records