Anisodactylus dulcicollis

(LaFerté-Sénectère, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records767

Data sources7

Biological traits0

DNA specimens102

eDNA detections100

Sources7 archives

Databases and archives Anisodactylus dulcicollis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility767 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI100 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics102 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF767 records

Environmental DNA1 datasets · 1 countries100 detections

DNA & barcodingBOLD102 specimens

01Narrative

Anisodactylus dulcicollis is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding102 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus dulcicollis has left across the world's sequence archives.

At a glance

DNA specimens102

BINs2

Marker genes1

eDNA detections100

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus92 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

196Amostly conserved

197Tmostly conserved

199Amostly conserved

238Tmostly conserved

250Cvariable

271Amostly conserved

277Tmostly conserved

295Amostly conserved

312Gmostly conserved

433Amostly conserved

454Amostly conserved

457Tmostly conserved

463Cmostly conserved

490Tmostly conserved

529Tmostly conserved

550Avariable

559Amostly conserved

571Cmostly conserved

641Cmostly conserved

646Tmostly conserved

AACATTATATTTCATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes23

BINs2

Most divergent pair6.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus opaculussame genus5.3%Anisodactylus haplomussame genus5.8%Anisodactylus binotatussame genus5.9%Anisodactylus texanussame genus5.9%Anisodactylus nigritasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type767 records

Wild obs. + sensor6

Museum / vouchered761

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 550≤10 km 8

558 georeferenced · 203 without coordinates

Open the institutions mapphysical evidence761

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	589
University of Alberta Museums (UAM)location not on record	81
College Station, US	51
NEON Biorepository at Arizona State Universitylocation not on record	10
Colorado State Universitylocation not on record	8
Royal Saskatchewan Museumlocation not on record	7
Essig Museum of Entomologylocation not on record	3
Canadian Centre for DNA Barcodinglocation not on record	2
Lexington, US	2
EWIClocation not on record	2
CUlocation not on record	1
Carnegie Museum of Natural Historylocation not on record	1
Lubbock, US	1
Decorah, US	1
OSUClocation not on record	1
Champaign, US	1

16 institutions · 761 of 761 vouchered records shown

09Environmental DNA100 detections

Where the DNA of Anisodactylus dulcicollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found100

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 100 detections have coordinates

Open the map1 country0

cultivatedCropsgrasslandHerbaceouspastureHayevergreenForestdeciduousForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 17.1–26.7

Seasonal swing summer↔winter23.6 °C

Max temp (day)27.8 °C 22.5–32.4

Min temp (night)18.8 °C 12.6–22.3

Precipitation104 mm/mo 85.6–117

Air humidity57.0 % 55.4–59.5

Moisture balance-55.3 mm/mo -82.1–-10.3

Vapour deficit1,168 Pa 851–1,476

Wind speed3.30 m/s 2.10–4.80

Cloud cover36.3 % 26.1–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 100 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)