Anisodactylus opaculus

(LeConte, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anisodactylus

At a glance

Occurrence records517

Data sources6

Biological traits0

DNA specimens79

eDNA detections77

Sources6 archives

Databases and archives Anisodactylus opaculus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility517 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF517 records

Environmental DNA1 datasets · 1 countries77 detections

DNA & barcodingBOLD79 specimens

01Narrative

Anisodactylus opaculus is a ground beetle in the family Carabidae ("ground beetles"), in the suborder Adephaga ("ground and water beetles").bugguide.net Anisodactylus opaculus species information.Integrated Taxonomic Information System (ITIS)Encyclopedia of Life Anisodactylus opaculus species overview. Anisodactylus opaculus is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anisodactylus opaculus has left across the world's sequence archives.

At a glance

DNA specimens79

BINs2

Marker genes1

eDNA detections77

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus76 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

166Gmostly conserved

181Amostly conserved

256Cmostly conserved

274Cmostly conserved

307Cmostly conserved

316Gmostly conserved

358Amostly conserved

370Avariable

631Amostly conserved

634Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes34

BINs2

Most divergent pair6.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus texanussame genus2.0%Anisodactylus laetussame genus5.2%Anisodactylus dulcicollissame genus5.3%Anisodactylus caenussame genus5.5%Anisodactylus discoideussame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type517 records

Wild obs. + sensor3

Museum / vouchered514

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 231≤1 km 2≤10 km 14>10 km 4

251 georeferenced · 263 without coordinates

Open the institutions mapphysical evidence514

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	259
University of Alberta Museums (UAM)location not on record	140
Mississippi State, US	48
College Station, US	27
Colorado State Universitylocation not on record	10
University of Alabamalocation not on record	8
Provo, US	5
Essig Museum of Entomologylocation not on record	5
Royal Saskatchewan Museumlocation not on record	5
NEON Biorepository at Arizona State Universitylocation not on record	3
Lubbock, US	2
CUlocation not on record	1
Lexington, US	1

13 institutions · 514 of 514 vouchered records shown

09Environmental DNA77 detections

Where the DNA of Anisodactylus opaculus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map1 country0

cultivatedCropsgrasslandHerbaceousshrubScrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 15.5–28.2

Seasonal swing summer↔winter27.8 °C

Max temp (day)31.4 °C 23.1–34.2

Min temp (night)20.8 °C 11.1–23.4

Precipitation106 mm/mo 52.6–139

Air humidity55.9 % 51.8–57.3

Moisture balance-86.7 mm/mo -160–-39.9

Vapour deficit1,460 Pa 885–1,855

Wind speed4.20 m/s 3.80–4.80

Cloud cover26.2 % 24.9–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)