Anhimella contrahens

Walker, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anhimella

At a glance

Occurrence records226

Data sources7

Biological traits0

DNA specimens12

eDNA detections16

Sources7 archives

Databases and archives Anhimella contrahens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anhimella contrahens is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Anhimella contrahens is 10530.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anhimella contrahens has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

34Avariable

37Amostly conserved

40Amostly conserved

79Amostly conserved

85Cmostly conserved

91Tmostly conserved

100Avariable

127Tmostly conserved

181Gmostly conserved

205Tvariable

206Cmostly conserved

235Cvariable

253Amostly conserved

265Cmostly conserved

266Tmostly conserved

268Amostly conserved

287Tmostly conserved

316Avariable

343Cvariable

346Tmostly conserved

352Amostly conserved

358Cvariable

361Tmostly conserved

364Tmostly conserved

367Tmostly conserved

368Gmostly conserved

394Cmostly conserved

406Tmostly conserved

407Tvariable

421Tmostly conserved

433Amostly conserved

451Tmostly conserved

460Cmostly conserved

475Tmostly conserved

506Amostly conserved

532Cmostly conserved

541Amostly conserved

574Amostly conserved

589Tvariable

625Amostly conserved

628Gmostly conserved

640Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes8

BINs2

Most divergent pair4.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anhimella pacificasame genus5.2%Eucereon consortasame order6.1%Anhimella perbrunneasame genus6.1%Agrotis porphyricollissame family6.4%Actebia praecoxsame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor67

Museum / vouchered159

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 32≤1 km 9≤10 km 5>10 km 11

57 georeferenced · 10 without coordinates

Open the mapobservation + sensor67

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 15≤1 km 3≤10 km 26>10 km 12

56 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	39
New Haven, US	26
Royal Saskatchewan Museumlocation not on record	24
Oregon State Arthropod Collectionlocation not on record	14
St. Paul, US	13
Colorado State Universitylocation not on record	12
Vernal, US	11
San Diego, US	7
East Lansing, US	6
Santa Cruz, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
ASUlocation not on record	1

12 institutions · 158 of 159 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Anhimella contrahens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

UplandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 16.5–28.0

Seasonal swing summer↔winter17.3 °C

Max temp (day)31.2 °C 21.7–35.4

Min temp (night)17.0 °C 10.9–21.4

Precipitation13.0 mm/mo 11.4–96.4

Air humidity48.7 % 46.9–58.4

Moisture balance-165 mm/mo -178–-52.3

Vapour deficit1,437 Pa 814–1,988

Wind speed4.20 m/s 2.80–5.30

Cloud cover12.2 % 12.1–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)