Anhimella perbrunnea

Grote, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anhimella

At a glance

Occurrence records72

Data sources7

Biological traits0

DNA specimens34

eDNA detections34

Sources7 archives

Databases and archives Anhimella perbrunnea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility72 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF72 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD34 specimens

01Narrative

Anhimella perbrunnea is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Anhimella perbrunnea is 10529.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anhimella perbrunnea has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections34

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

3Tvariable

32Amostly conserved

158Avariable

170Tvariable

203Avariable

263Tvariable

272Cvariable

285Tvariable

347Cvariable

359Cvariable

515Tvariable

644Tmostly conserved

CATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes6

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis vetustasame family5.6%Sideridis implexasame family5.6%Sideridis fuscoluteasame family5.6%Sideridis vindemialissame family6.1%Sideridis roseasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type72 records

Wild obs. + sensor11

Museum / vouchered61

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 5≤1 km 1≤10 km 1

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 14≤1 km 8≤10 km 1

23 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	26
New Haven, US	11
Essig Museum of Entomologylocation not on record	9
Santa Cruz, US	3
St. Paul, US	2
Centre for Biodiversity Genomicslocation not on record	2
Helsinki, FI	1

7 institutions · 54 of 61 vouchered records shown · 7 without an institution code

09Environmental DNA34 detections

Where the DNA of Anhimella perbrunnea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

3. Shrubland | 3.4. Temperate Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 15.2–24.5

Seasonal swing summer↔winter9.50 °C

Max temp (day)21.9 °C 18.4–32.7

Min temp (night)13.2 °C 11.2–17.0

Precipitation14.7 mm/mo 1.10–42.2

Air humidity62.1 % 43.5–65.8

Moisture balance-87.5 mm/mo

Vapour deficit719 Pa 568–1,750

Wind speed3.70 m/s

Cloud cover25.9 % 11.8–31.6

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)