Agrotis porphyricollis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Agrotis

At a glance

Occurrence records4 525

Data sources7

Biological traits0

DNA specimens247

eDNA detections243

Sources7 archives

Databases and archives Agrotis porphyricollis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 525 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI243 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics247 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 525 records

Environmental DNA1 datasets · 1 countries243 detections

DNA & barcodingBOLD247 specimens

01Narrative

Agrotis porphyricollis (variable cutworm) is a noctuid moth. It is found in Tasmania, Victoria and New South Wales. The wingspan is about 30 mm. The larvae stay underground during daytime and emerge at night to feed. They are considered a pest on Beta vulgaris and Solanum tuberosum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding247 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrotis porphyricollis has left across the world's sequence archives.

At a glance

DNA specimens247

BINs2

Marker genes2

eDNA detections243

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus240 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

40Avariable

50Tvariable

67Gvariable

82Cmostly conserved

85Avariable

97Tvariable

163Tvariable

220Cvariable

268Tvariable

385Tvariable

442Tvariable

478Cvariable

536Tvariable

547Avariable

556Tvariable

562Avariable

613Tvariable

616Tvariable

622Avariable

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGGGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes17

BINs2

Most divergent pair3.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrotis chretienisame genus3.0%Agrotis turatiisame genus3.2%Agrotis trifurcasame genus3.2%Agrotis endogaeasame genus3.2%Agrotis vetustasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 525 records

Wild obs. + sensor2 083

Museum / vouchered361

Other2 081

Origin

Native3

Range

Area of Occupancy AOO2 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 864≤1 km 472≤10 km 156>10 km 97

1 589 georeferenced · 494 without coordinates

Open the mapobservation + sensor2 083

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 83≤10 km 5

88 georeferenced · 273 without coordinates

Open the institutions mapphysical evidence361

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	182
Tasmanian Museum & Art Gallerylocation not on record	75
QVMAGlocation not on record	69
Tallinn, EE	15
Natick, US	10
Australian National Insect Collectionlocation not on record	2
Australian National Fish Collectionlocation not on record	1
Helsinki, FI	1

8 institutions · 355 of 361 vouchered records shown · 6 without an institution code

09Environmental DNA243 detections

Where the DNA of Agrotis porphyricollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found243

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 243 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.0–22.0

Seasonal swing summer↔winter10.3 °C

Max temp (day)19.2 °C 16.4–25.9

Min temp (night)10.1 °C 8.20–16.5

Precipitation55.7 mm/mo 32.7–131

Air humidity57.4 % 54.7–61.6

Moisture balance-53.0 mm/mo -96.3–-12.4

Vapour deficit698 Pa 574–1,047

Wind speed3.60 m/s 2.10–4.20

Cloud cover24.6 % 13.7–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 243 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agrotis porphyricollis

At a glance

Sources7 archives

At a glance

Record type4 525 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 525 records