Andrena wheeleri

Graenicher, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records365

Data sources6

Biological traits1

DNA specimens31

eDNA detections36

Sources6 archives

Databases and archives Andrena wheeleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF365 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD31 specimens

01Narrative

Andrena wheeleri is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Graenicher.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.3 mm

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena wheeleri has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.39%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

20Gmostly conserved

511Gmostly conserved

616Tmostly conserved

GATACTGTACTTCATTTTCGCCATATGAGCAGGAATAATTGGAGCCTCACTAAGATTTATTATCCGAATAGAGTTAAGAAACCCAGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena nasoniisame genus10.3%Andrena pallidifoveasame genus10.9%Andrena lepidasame genus11.2%Andrena mehelyisame genus12.0%Andrena haemorrhoasame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type365 records

Wild obs. + sensor1

Museum / vouchered362

Other2

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 5≤1 km 26≤10 km 34>10 km 5

70 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence362

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	47
Cornell University Insect Collectionlocation not on record	41
WIlocation not on record	40
	35
Champaign, US	33
Wuzhou, CN	28
Beltsville, US	27
Saint John, CA	25
Cleveland Museum of Natural History, OH (CLEV)location not on record	22
Cambridge, US	12
Toronto, CA	9
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	8
White River Junction, US	7
Royal Saskatchewan Museumlocation not on record	4
Decorah, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
UNHClocation not on record	2
University Park, US	1
Colorado State Universitylocation not on record	1
University of Western Ontariolocation not on record	1
Washington, US	1
OSUClocation not on record	1
York University, Packer Collectionlocation not on record	1
University of Guelphlocation not on record	1

24 institutions · 354 of 362 vouchered records shown · 8 without an institution code

09Environmental DNA36 detections

Where the DNA of Andrena wheeleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

Agricultural fieldagricultural fieldStabilizing duneWetlandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.3–18.3

Seasonal swing summer↔winter26.1 °C

Max temp (day)19.4 °C 15.4–23.7

Min temp (night)11.2 °C 6.90–13.5

Precipitation84.2 mm/mo 64.5–107

Air humidity56.9 % 53.3–61.9

Moisture balance-42.9 mm/mo -74.1–4.70

Vapour deficit685 Pa 536–904

Wind speed3.80 m/s 2.00–4.30

Cloud cover43.8 % 40.3–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)