Andrena violae

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records3 748

Data sources6

Biological traits3

DNA specimens4

eDNA detections1

Sources6 archives

Databases and archives Andrena violae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 748 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF3 748 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD4 specimens

01Narrative

Andrena violae is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1891 door Robertson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology3

Body length0.95 cm

Intertegular distance (ITD)2 mm

Wing length6.5 mm

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena violae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

52Cvariable

58Cvariable

634Tvariable

TATATTATACTTTATATTCGCCATATGAGCAGGTATAATTGGAGCATCTCTCAGATTCATTATTCGAATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes3

BIN1

Most divergent pair0.46%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena pandelleisame genus10.5%Andrena parathoracicasame genus10.6%Andrena albopunctatasame genus10.9%Andrena intermediasame genus10.9%Andrena solasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 748 records

Wild obs. + sensor72

Museum / vouchered3 676

Range

Area of Occupancy AOO1 624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 38≤1 km 8≤10 km 3>10 km 16

65 georeferenced · 7 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 4≤1 km 15≤10 km 109>10 km 4

132 georeferenced · 3 544 without coordinates

Open the institutions mapphysical evidence3 676

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	2 105
University Park, US	589
Lexington, US	577
Champaign, US	120
Beltsville, US	110
North Carolina State University Insect Museumlocation not on record	57
New Haven, US	27
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	18
	14
LULlocation not on record	8
FWSlocation not on record	7
OSUClocation not on record	6
UNHClocation not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Cornell University Insect Collectionlocation not on record	4
WIlocation not on record	4
Cambridge, US	4
Philadelphia, US	3
Blacksburg, US	2
Wuzhou, CN	2
White River Junction, US	2
SUNY ESFlocation not on record	1
University of Guelphlocation not on record	1
Mississippi State, US	1

24 institutions · 3 672 of 3 676 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Andrena violae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena violae

At a glance

Sources6 archives

Size & morphology3

At a glance

Record type3 748 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 748 records