Andrena trevoris

Cockerell, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records79

Data sources6

Biological traits0

DNA specimens34

eDNA detections33

Sources6 archives

Databases and archives Andrena trevoris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD34 specimens

01Narrative

Andrena trevoris is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1897 door Cockerell.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena trevoris has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

4Amostly conserved

5Cmostly conserved

19Tmostly conserved

79Amostly conserved

112Tmostly conserved

154Cmostly conserved

313Amostly conserved

316Amostly conserved

359Gmostly conserved

379Cmostly conserved

397Cmostly conserved

502Amostly conserved

520Tmostly conserved

571Cmostly conserved

TATACTATACTTCATATTTGCAATATGGGCAGGAATAATAGGGGCCTCTCTTAGCTTCATCATCCGAATAGAATTAAGAAACCCCGGCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes5

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena mackieaesame genus12.6%Andrena transitoriasame genus12.9%Andrena medionitenssame genus13.2%Andrena haemorrhoasame genus13.3%Andrena viereckisame genus13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor1

Museum / vouchered78

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 21>10 km 1

23 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	27
Champaign, US	14
	8
Roberts Creek, CA	4
Vancouver, CA	4
WSUClocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
WIlocation not on record	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	2
Universidad Católica de Manizaleslocation not on record	2
Washington, US	1
Centre for Biodiversity Genomicslocation not on record	1
Chicago, US	1

13 institutions · 73 of 78 vouchered records shown · 5 without an institution code

09Environmental DNA33 detections

Where the DNA of Andrena trevoris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

1. Forest & Woodlandagricultural fieldAgricultural fieldGrasslandMixed habitat4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 12.4–17.5

Seasonal swing summer↔winter23.1 °C

Max temp (day)20.5 °C 17.4–23.7

Min temp (night)10.4 °C 5.80–11.2

Precipitation57.2 mm/mo 31.8–73.2

Air humidity55.4 % 51.8–59.9

Moisture balance-66.5 mm/mo -97.1–-54.1

Vapour deficit699 Pa 624–922

Wind speed2.00 m/s 1.10–2.50

Cloud cover38.6 % 31.5–40.7

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)