Andrena medionitens

Cockerell, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records1 571

Data sources7

Biological traits1

DNA specimens42

eDNA detections50

Sources7 archives

Databases and archives Andrena medionitens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 571 records

Environmental DNA1 datasets · 2 countries50 detections

DNA & barcodingBOLD42 specimens

01Narrative

The western red-legged miner bee (Andrena medionitens) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.86 mm

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena medionitens has left across the world's sequence archives.

At a glance

DNA specimens42

BINs3

Marker genes1

eDNA detections50

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Tmostly conserved

5Cmostly conserved

13Tmostly conserved

34Amostly conserved

67Amostly conserved

74Cmostly conserved

85Cmostly conserved

91Cmostly conserved

103Cmostly conserved

238Gmostly conserved

595Tmostly conserved

TATACTATATTTTATTTTCGCTATATGAGCAGGAATAATTGGAGCTTCCCTAAGATTCATTATTCGAATAGAACTAAGTAATCCCGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes5

BINs3

Most divergent pair11.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena viereckisame genus3.9%Andrena sladenisame genus9.3%Andrena mackieaesame genus9.4%Andrena w-scriptasame genus9.4%Andrena knuthianasame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 571 records

Museum / vouchered1 571

Range

Area of Occupancy AOO1 200 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 39≤10 km 122>10 km 1

162 georeferenced · 1 409 without coordinates

Open the institutions mapphysical evidence1 571

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	1 121
Wuzhou, CN	122
Champaign, US	97
	43
St. Paul, US	40
University of Alabamalocation not on record	39
Royal Saskatchewan Museumlocation not on record	25
WSUClocation not on record	21
WIlocation not on record	17
US	12
Colorado State Universitylocation not on record	6
Universidad Católica de Manizaleslocation not on record	6
Weber State University, Bird and Mammal Collectionlocation not on record	5
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	4
Cambridge, US	3
Awka, NG	3
OSUClocation not on record	2
Royal Saskatchewan Museumlocation not on record	1
Vancouver, CA	1
Canadian Museum of Naturelocation not on record	1
Washington, US	1

21 institutions · 1 570 of 1 571 vouchered records shown · 1 without an institution code

09Environmental DNA50 detections

Where the DNA of Andrena medionitens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map2 countries0

Stabilizing duneActive dune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 9.40–19.2

Seasonal swing summer↔winter25.6 °C

Max temp (day)22.9 °C 17.2–26.1

Min temp (night)10.6 °C 2.10–13.8

Precipitation45.9 mm/mo 15.7–77.7

Air humidity51.4 % 43.8–53.3

Moisture balance-99.7 mm/mo -150–-66.3

Vapour deficit901 Pa 574–1,168

Wind speed3.80 m/s 2.20–4.60

Cloud cover36.6 % 21.4–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena medionitens

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 571 records

Range

Museum / Voucheredphysical evidence

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 571 records