Andrena taraxaci

Giraud, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records897

Data sources5

Biological traits1

DNA specimens17

eDNA detections0

Sources5 archives

Databases and archives Andrena taraxaci's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility897 records↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF897 records

DNA & barcodingBOLD17 specimens

01Narrative

Andrena taraxaci Giraud, 1861 è un insetto apoideo della famiglia Andrenidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.68 mm

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena taraxaci has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

34Amostly conserved

88Gvariable

89Amostly conserved

100Tvariable

115Cvariable

214Avariable

217Avariable

316Gvariable

328Amostly conserved

331Amostly conserved

386Tvariable

409Tvariable

416Avariable

502Cvariable

520Tmostly conserved

539Tvariable

548Tmostly conserved

574Tvariable

613Tvariable

625Avariable

628Amostly conserved

631Avariable

653Cvariable

AATGCTATATTTCATTTTCGCAATATGAGCAGGAATAATTGGAGCATCAATAAGATTTATTATTCGAATAGAATTAAGTAACCCAGGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena pastellensissame genus1.5%Andrena rhenanasame genus6.6%Andrena orientanasame genus6.7%Andrena stabianasame genus6.7%Andrena curtivalvissame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type897 records

Wild obs. + sensor171

Museum / vouchered705

Other21

Origin

Native91

Range

Area of Occupancy AOO1 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 33≤1 km 34≤10 km 90

157 georeferenced · 14 without coordinates

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 10≤1 km 483≤10 km 164>10 km 2

659 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence705

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	475
Bern, CH	31
UMONSlocation not on record	31
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	20
PRUNlocation not on record	18
Zürich, CH	15
ZSMlocation not on record	11
Wuzhou, CN	8
PRAZlocation not on record	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Philadelphia, US	4
Musee d'Histoire Naturallelocation not on record	4
Champaign, US	3
	2
Bavarian State Collection of Zoologylocation not on record	2
University of Monslocation not on record	1
MNHWlocation not on record	1
WIlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1

19 institutions · 639 of 705 vouchered records shown · 66 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)