Andrena rhenana

E.Stöckhert, 1930 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records398

Data sources7

Biological traits1

DNA specimens34

eDNA detections26

Sources7 archives

Databases and archives Andrena rhenana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF398 records

Environmental DNA1 datasets · 3 countries26 detections

DNA & barcodingBOLD34 specimens

01Narrative

Andrena rhenana is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1930 door Stoeckhert.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.17 mm

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena rhenana has left across the world's sequence archives.

At a glance

DNA specimens34

BINs3

Marker genes3

eDNA detections26

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

46Cmostly conserved

94Tmostly conserved

118Amostly conserved

133Cmostly conserved

211Gmostly conserved

268Tmostly conserved

295Amostly conserved

297Tmostly conserved

313Gmostly conserved

334Gmostly conserved

337Tmostly conserved

340Amostly conserved

349Tmostly conserved

355Tmostly conserved

367Amostly conserved

403Cmostly conserved

436Cmostly conserved

442Cmostly conserved

451Tmostly conserved

502Tvariable

530Tmostly conserved

574Gmostly conserved

607Cmostly conserved

631Cmostly conserved

ACTATACTTCATTTTCGCAATATGAGCAGGAATAATTGGAGCATCCCTAAGATTTATTATTCGAATAGAATTAAGTAATCCAGGAAATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes8

BINs3

Most divergent pair6.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena taraxacisame genus6.6%Andrena stabianasame genus6.6%Andrena pastellensissame genus7.0%Andrena orientanasame genus7.6%Andrena curtivalvissame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★COI-5PNMT116S

animal barcoderibosomal

08Occurrence & distribution

Record type398 records

Wild obs. + sensor262

Museum / vouchered91

Other45

Origin

Native26

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 17≤1 km 8≤10 km 122>10 km 8

155 georeferenced · 107 without coordinates

Open the mapobservation + sensor262

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 4≤1 km 3≤10 km 57

64 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	16
Paro, BT	6
Coimbra, PT	5
Musee d'Histoire Naturallelocation not on record	4
ZSMlocation not on record	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
	2
Bavarian State Collection of Zoologylocation not on record	2
Bern, CH	2
University of Florence, Department of Biologylocation not on record	2
NMOKlocation not on record	1

11 institutions · 46 of 91 vouchered records shown · 45 without an institution code

09Environmental DNA26 detections

Where the DNA of Andrena rhenana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

kiwifruit orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 5.70–14.7

Seasonal swing summer↔winter15.4 °C

Max temp (day)14.9 °C 8.80–18.9

Min temp (night)6.00 °C 2.70–10.0

Precipitation65.0 mm/mo 55.0–109

Air humidity59.7 % 56.6–66.2

Moisture balance-27.8 mm/mo -50.8–62.8

Vapour deficit532 Pa 310–673

Wind speed3.20 m/s 2.70–4.60

Cloud cover41.3 % 37.9–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)