Andrena orientana

Warncke, 1965 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records66

Data sources6

Biological traits0

DNA specimens12

eDNA detections12

Sources6 archives

Databases and archives Andrena orientana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF66 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD12 specimens

01Narrative

Andrena orientana is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1965 door Warncke.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena orientana has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

40Tmostly conserved

112Cvariable

157Cvariable

184Gvariable

211Avariable

294Tmostly conserved

298Tmostly conserved

310Tvariable

316Avariable

331Avariable

337Amostly conserved

340Cvariable

363Tmostly conserved

406Cmostly conserved

457Cmostly conserved

463Cvariable

487Tvariable

589Cvariable

613Tmostly conserved

628Amostly conserved

631Gmostly conserved

646Cmostly conserved

AATACTATATTTCATTTTTGCTATATGATCAGGAATAATTGGAGCATCACTAAGATTTATTATTCGAATAGAATTAAGTAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes8

BIN1

Most divergent pair2.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena stabianasame genus6.4%Andrena taraxacisame genus6.7%Andrena curtivalvissame genus7.0%Andrena pastellensissame genus7.4%Andrena rhenanasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type66 records

Museum / vouchered65

Other1

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 64

64 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence65

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	64

1 institutions · 64 of 65 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Andrena orientana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 11.8–15.0

Seasonal swing summer↔winter15.4 °C

Max temp (day)16.5 °C 15.7–18.2

Min temp (night)8.60 °C 6.40–12.3

Precipitation56.8 mm/mo 36.2–118

Air humidity57.6 % 54.4–58.4

Moisture balance-43.0 mm/mo -83.4–57.0

Vapour deficit681 Pa 582–723

Wind speed2.60 m/s 2.00–3.50

Cloud cover39.9 % 33.9–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)