Andrena macoupinensis

Robertson, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records407

Data sources7

Biological traits0

DNA specimens3

eDNA detections6

Sources7 archives

Databases and archives Andrena macoupinensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF407 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD3 specimens

01Narrative

The Macoupin County miner bee (Andrena macoupinensis) is a species of miner bee in the family Andrenidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena macoupinensis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.6%

Haplotypes1

BINs2

Where individuals differ — all 16 variable positions, in barcode order

120Cvariable

282Tvariable

312Gvariable

336Tvariable

342Avariable

348Gvariable

351Cvariable

382Tvariable

405Cvariable

471Avariable

528Cvariable

567Tvariable

597Cvariable

609Tvariable

621Tvariable

642Cvariable

CTGTACTTCATTTTCGCAATATGGGCAGGCATAGTTGGTGCATCCCTAAGATTCATTATTCGTATAGAATTAAGAAATCCAGGAAATTGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena milwaukeensissame genus7.2%Andrena fucatasame genus7.6%Andrena clarkellasame genus7.7%Andrena rufosignatasame genus7.7%Andrena birtwellisame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type407 records

Museum / vouchered407

Range

Area of Occupancy AOO528 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 5≤10 km 70>10 km 1

76 georeferenced · 331 without coordinates

Open the institutions mapphysical evidence407

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	122
Wuzhou, CN	81
US	69
Champaign, US	68
North Carolina State University Insect Museumlocation not on record	35
	10
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	6
Philadelphia, US	4
WSUClocation not on record	3
Universidad Católica de Manizaleslocation not on record	2
University Park, US	2
WIlocation not on record	1
Cambridge, US	1
Mississippi State, US	1
Cornell University Insect Collectionlocation not on record	1

15 institutions · 406 of 407 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Andrena macoupinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 11.8–16.6

Seasonal swing summer↔winter21.4 °C

Max temp (day)20.0 °C 18.5–23.5

Min temp (night)6.40 °C 5.20–8.50

Precipitation30.0 mm/mo 12.6–34.4

Air humidity51.2 % 41.4–53.2

Moisture balance-107 mm/mo -147–-87.8

Vapour deficit742 Pa 650–1,114

Wind speed2.60 m/s 2.10–2.80

Cloud cover34.8 % 30.0–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)