Andrena rufosignata

Cockerell, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records759

Data sources7

Biological traits1

DNA specimens37

eDNA detections40

Sources7 archives

Databases and archives Andrena rufosignata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility759 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF759 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD37 specimens

01Narrative

The red-faced miner bee (Andrena rufosignata) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.57 mm

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena rufosignata has left across the world's sequence archives.

At a glance

DNA specimens37

BINs2

Marker genes1

eDNA detections40

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

16Tmostly conserved

19Tvariable

31Avariable

34Tvariable

40Tmostly conserved

67Tmostly conserved

82Tvariable

103Tmostly conserved

139Cmostly conserved

292Tvariable

310Tvariable

322Tvariable

331Avariable

340Cvariable

343Amostly conserved

364Cvariable

386Tvariable

400Tvariable

403Cvariable

427Tvariable

463Tvariable

499Cvariable

544Tvariable

550Amostly conserved

571Cmostly conserved

577Avariable

578Tvariable

583Amostly conserved

625Avariable

628Avariable

646Cvariable

TATACTATACTTTATTTTTGCAATATGAGCAGGTATAGTTGGAGCATCTTTAAGATTTATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes9

BINs2

Most divergent pair4.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena clarkellasame genus5.2%Andrena milwaukeensissame genus5.5%Andrena schuhisame genus5.8%Andrena hemileucasame genus5.9%Andrena vicinoidessame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type759 records

Wild obs. + sensor93

Museum / vouchered666

Range

Area of Occupancy AOO1 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 36≤1 km 28≤10 km 4>10 km 9

77 georeferenced · 16 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 80≤1 km 72≤10 km 68>10 km 6

226 georeferenced · 440 without coordinates

Open the institutions mapphysical evidence666

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
White River Junction, US	127
	63
US	59
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	56
Cornell University Insect Collectionlocation not on record	48
Champaign, US	47
Edmonton, CA	40
Beltsville, US	28
UNHClocation not on record	25
New Haven, US	22
Saint John, CA	20
WIlocation not on record	17
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	12
Wuzhou, CN	12
Toronto, CA	11
Vancouver, CA	11
Vermont Center for Ecostudieslocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Cambridge, US	4
Royal Saskatchewan Museumlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Toronto, CA	2
St. Paul, US	2
Weber State University, Bird and Mammal Collectionlocation not on record	2
New Haven, US	1
OSUClocation not on record	1
Roberts Creek, CA	1
VTFPRlocation not on record	1
Chicago, US	1
WSUClocation not on record	1
University of Central Floridalocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Anchorage, US	1

33 institutions · 636 of 666 vouchered records shown · 30 without an institution code

09Environmental DNA40 detections

Where the DNA of Andrena rufosignata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

ForestRiparian Zoneroadside forest margin4. Native Grassland|4.2 Subarctic GrasslandBrookMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 7.80–16.2

Seasonal swing summer↔winter24.2 °C

Max temp (day)17.4 °C 11.8–20.6

Min temp (night)6.40 °C 2.40–12.8

Precipitation102 mm/mo 62.4–141

Air humidity60.7 % 54.8–63.3

Moisture balance-14.4 mm/mo -39.6–25.6

Vapour deficit615 Pa 419–713

Wind speed3.30 m/s 2.00–5.20

Cloud cover49.5 % 37.9–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)