Andrena hemileuca

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records319

Data sources7

Biological traits0

DNA specimens5

eDNA detections11

Sources7 archives

Databases and archives Andrena hemileuca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD5 specimens

01Narrative

The partly-haired miner bee (Andrena hemileuca) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena hemileuca has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.12%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

386Cmostly conserved

472Cmostly conserved

CATACTATATTTTATTTTTGCAATATGGGCAGGTATAATCGGAGCGTCTCTAAGATTTATCATTCGTATAGAATTAAGAAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena clarkellasame genus5.8%Andrena vicinoidessame genus5.8%Andrena rufosignatasame genus5.9%Andrena schuhisame genus6.5%Andrena carolinasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type319 records

Wild obs. + sensor1

Museum / vouchered318

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 1≤1 km 1≤10 km 32

34 georeferenced · 284 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	195
Beltsville, US	44
Champaign, US	29
BBSLlocation not on record	23
	9
Weber State University, Bird and Mammal Collectionlocation not on record	8
WSUClocation not on record	4
Wuzhou, CN	4
Vancouver, CA	2

9 institutions · 318 of 318 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Andrena hemileuca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 7.70–13.5

Seasonal swing summer↔winter13.7 °C

Max temp (day)17.6 °C 11.5–18.8

Min temp (night)6.20 °C 4.00–8.20

Precipitation82.4 mm/mo 63.9–197

Air humidity60.0 % 58.3–63.9

Moisture balance-29.5 mm/mo -60.0–120

Vapour deficit574 Pa 377–641

Wind speed2.10 m/s 1.70–2.60

Cloud cover41.6 % 38.4–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)