Andrena carolina

Viereck, 1909 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records983

Data sources7

Biological traits1

DNA specimens23

eDNA detections25

Sources7 archives

Databases and archives Andrena carolina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility983 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF983 records

Environmental DNA1 datasets · 1 countries25 detections

DNA & barcodingBOLD23 specimens

01Narrative

The Carolina miner bee (Andrena carolina) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.9 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena carolina has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections25

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

19Cmostly conserved

20Gmostly conserved

21Cmostly conserved

22Amostly conserved

56Tmostly conserved

58Tmostly conserved

199Tvariable

229Gmostly conserved

268Tmostly conserved

271Tmostly conserved

394Tmostly conserved

406Cmostly conserved

445Tmostly conserved

565Avariable

TATACTATACTTTATTTTCGCAATATGAGCAGGTATAATCGGAGCATCCCTAAGATTTATCATTCGTATAGAATTAAGAAACCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes3

BIN1

Most divergent pair0.46%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena clarkellasame genus6.3%Andrena vicinoidessame genus6.3%Andrena schuhisame genus6.5%Andrena hemileucasame genus6.5%Andrena rogenhoferisame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type983 records

Wild obs. + sensor49

Museum / vouchered931

Other3

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 32≤1 km 8≤10 km 2>10 km 1

43 georeferenced · 6 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 17≤1 km 52≤10 km 92>10 km 5

166 georeferenced · 765 without coordinates

Open the institutions mapphysical evidence931

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	195
	170
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	141
Cornell University Insect Collectionlocation not on record	79
White River Junction, US	66
Champaign, US	57
University Park, US	55
Cambridge, US	27
WIlocation not on record	20
UNHClocation not on record	18
Saint John, CA	15
New Haven, US	15
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	12
St. Paul, US	9
Beltsville, US	8
OSUClocation not on record	7
LULlocation not on record	6
Lexington, US	4
Wuzhou, CN	4
Royal Saskatchewan Museumlocation not on record	3
New Haven, US	3
York University, Packer Collectionlocation not on record	2
University of Western Ontariolocation not on record	2
Blacksburg, US	1
VTFPRlocation not on record	1

25 institutions · 920 of 931 vouchered records shown · 11 without an institution code

09Environmental DNA25 detections

Where the DNA of Andrena carolina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map1 country0

Wetlandhighbush blueberry cropsMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 10.1–15.2

Seasonal swing summer↔winter25.0 °C

Max temp (day)16.6 °C 14.5–20.8

Min temp (night)10.2 °C 6.20–11.8

Precipitation94.2 mm/mo 79.2–116

Air humidity60.1 % 56.5–61.5

Moisture balance-14.4 mm/mo -54.2–11.3

Vapour deficit544 Pa 493–747

Wind speed3.20 m/s 2.40–5.20

Cloud cover49.7 % 40.4–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)