Andrena livens

Pérez, 1895 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records136

Data sources6

Biological traits0

DNA specimens14

eDNA detections3

Sources6 archives

Databases and archives Andrena livens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF136 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD14 specimens

01Narrative

Andrena livens is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1895 door Pérez.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena livens has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes2

eDNA detections3

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 95 variable positions, in barcode order

1Gmostly conserved

7Cmostly conserved

10Tmostly conserved

27Cmostly conserved

37Tmostly conserved

40Amostly conserved

43Amostly conserved

46Amostly conserved

47Tmostly conserved

49Amostly conserved

61Cmostly conserved

64Tmostly conserved

67Amostly conserved

76Amostly conserved

94Cvariable

97Tmostly conserved

98Amostly conserved

103Cmostly conserved

112Tmostly conserved

121Tmostly conserved

127Amostly conserved

130Amostly conserved

133Tmostly conserved

136Cmostly conserved

139Tmostly conserved

154Tmostly conserved

160Tmostly conserved

163Amostly conserved

169Cmostly conserved

203Tmostly conserved

214Tmostly conserved

229Amostly conserved

232Cmostly conserved

238Amostly conserved

257Tmostly conserved

260Tmostly conserved

265Tmostly conserved

273Cmostly conserved

284Amostly conserved

286Tmostly conserved

295Amostly conserved

300Cmostly conserved

301Gmostly conserved

302Cmostly conserved

313Gmostly conserved

316Tmostly conserved

332Gmostly conserved

340Cmostly conserved

344Tmostly conserved

352Amostly conserved

364Cmostly conserved

370Amostly conserved

373Cmostly conserved

376Cmostly conserved

383Tmostly conserved

391Cmostly conserved

394Cmostly conserved

397Amostly conserved

400Tmostly conserved

403Tmostly conserved

406Tmostly conserved

418Tmostly conserved

426Tmostly conserved

430Amostly conserved

432Cmostly conserved

442Tmostly conserved

445Tmostly conserved

454Cmostly conserved

494Cmostly conserved

496Amostly conserved

497Cmostly conserved

517Tmostly conserved

526Amostly conserved

529Tmostly conserved

532Tmostly conserved

536Tmostly conserved

539Gmostly conserved

541Amostly conserved

544Tmostly conserved

550Amostly conserved

553Amostly conserved

559Tmostly conserved

568Tmostly conserved

575Tmostly conserved

578Cmostly conserved

580Tmostly conserved

592Cmostly conserved

601Tmostly conserved

607Tmostly conserved

610Tmostly conserved

613Cmostly conserved

628Tmostly conserved

631Cmostly conserved

637Cmostly conserved

649Tmostly conserved

GTTATACTTTATATTCGCAATATGAGCAGGAATAATTGGAGCATCATTAAGTTTTATTATCCGTATAGAACTAAGAAATCCAGGAAATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes5

BINs2

Most divergent pair13.6%

EuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena agnatasame genus8.9%Andrena nigroolivaceasame genus11.2%Andrena erigeniaesame genus11.9%Andrena ferrugineicrussame genus12.4%Andrena merulasame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type136 records

Wild obs. + sensor6

Museum / vouchered75

Other55

Origin

Native5

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤1 km 9≤10 km 10>10 km 3

22 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	10
Zürich, CH	8
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
Wuzhou, CN	3
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	3
Coimbra, PT	2
Provincia di Livornolocation not on record	1

7 institutions · 32 of 75 vouchered records shown · 43 without an institution code

09Environmental DNA3 detections

Where the DNA of Andrena livens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.3–18.0

Seasonal swing summer↔winter15.7 °C

Max temp (day)19.7 °C 19.4–22.1

Min temp (night)10.5 °C 10.2–12.8

Precipitation84.3 mm/mo 68.5–86.6

Air humidity59.9 % 59.7–60.4

Moisture balance-38.8 mm/mo -65.5–-37.5

Vapour deficit711 Pa 692–833

Wind speed3.20 m/s 3.20–3.60

Cloud cover41.9 % 39.8–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)