Andrena nigroolivacea

Dours, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records823

Data sources6

Biological traits1

DNA specimens19

eDNA detections19

Sources6 archives

Databases and archives Andrena nigroolivacea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility823 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF823 records

Environmental DNA1 datasets · 4 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Andrena nigroolivacea is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1873 door Dours.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.46 mm

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena nigroolivacea has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes3

eDNA detections19

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

16Cmostly conserved

79Cmostly conserved

100Tmostly conserved

112Cmostly conserved

157Gvariable

181Amostly conserved

223Tvariable

310Gmostly conserved

313Gvariable

328Amostly conserved

340Amostly conserved

349Gmostly conserved

355Cmostly conserved

424Tmostly conserved

430Gvariable

472Amostly conserved

589Cmostly conserved

628Gmostly conserved

ATTATATTTTATATTCGCTATATGAGCAGGAATAATTGGTGCCTCACTAAGATTTATCATCCGAATAGAATTAAGAAACCCAGGAAATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes4

BIN1

Most divergent pair2.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena livenssame genus11.2%Andrena aegyptiacasame genus11.9%Andrena allosasame genus12.6%Andrena agnatasame genus12.7%Andrena amietisame genus12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★COI-5PNMT116S

animal barcoderibosomal

08Occurrence & distribution

Record type823 records

Wild obs. + sensor244

Museum / vouchered391

Other188

Origin

Native136

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 18≤1 km 1≤10 km 106>10 km 6

131 georeferenced · 113 without coordinates

Open the mapobservation + sensor244

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 3≤1 km 18≤10 km 253>10 km 6

280 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence391

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	30
Philadelphia, US	23
	19
Musee d'Histoire Naturallelocation not on record	18
Zürich, CH	14
IMEDEAlocation not on record	12
ARTlocation not on record	8
Bern, CH	3
Coimbra, PT	3
Paro, BT	2
PRUNlocation not on record	2
Wuzhou, CN	2
NMOKlocation not on record	2
Paris, FR	1
Cambridge, US	1
University of Florence, Department of Biologylocation not on record	1
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

18 institutions · 143 of 391 vouchered records shown · 248 without an institution code

09Environmental DNA19 detections

Where the DNA of Andrena nigroolivacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map4 countries0

City parks and large gardenskiwifruit orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 5.20–19.0

Seasonal swing summer↔winter14.7 °C

Max temp (day)15.5 °C 8.20–19.8

Min temp (night)5.90 °C 2.50–18.2

Precipitation83.8 mm/mo 45.4–102

Air humidity62.9 % 59.7–67.2

Moisture balance-13.6 mm/mo -63.7–62.8

Vapour deficit523 Pa 292–825

Wind speed3.40 m/s 2.50–4.60

Cloud cover45.4 % 30.9–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)