Andrena hesperia

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records334

Data sources6

Biological traits0

DNA specimens33

eDNA detections15

Sources6 archives

Databases and archives Andrena hesperia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility334 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF334 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD33 specimens

01Narrative

Andrena hesperia Smith, 1853 è un insetto apoideo della famiglia Andrenidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena hesperia has left across the world's sequence archives.

At a glance

DNA specimens33

BINs6

Marker genes1

eDNA detections15

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

7Amostly conserved

10Cmostly conserved

19Cmostly conserved

46Tmostly conserved

58Tmostly conserved

74Cmostly conserved

97Tvariable

100Amostly conserved

115Tmostly conserved

118Tvariable

127Cvariable

133Cvariable

136Cmostly conserved

139Amostly conserved

157Tvariable

172Tmostly conserved

178Tmostly conserved

195Gmostly conserved

199Tmostly conserved

205Cmostly conserved

206Cvariable

223Tmostly conserved

261Gmostly conserved

265Tmostly conserved

298Avariable

310Tmostly conserved

316Tvariable

325Amostly conserved

328Gvariable

330Gmostly conserved

331Avariable

334Cvariable

340Cmostly conserved

343Avariable

346Amostly conserved

347Cvariable

349Amostly conserved

352Cmostly conserved

364Tmostly conserved

367Cvariable

373Tmostly conserved

376Amostly conserved

379Amostly conserved

391Tvariable

394Cvariable

400Cmostly conserved

403Amostly conserved

406Tvariable

409Tmostly conserved

412Avariable

418Avariable

421Cmostly conserved

439Tmostly conserved

442Tmostly conserved

445Tmostly conserved

448Tmostly conserved

451Amostly conserved

457Tmostly conserved

475Cvariable

494Cmostly conserved

496Gmostly conserved

499Avariable

500Cmostly conserved

502Amostly conserved

505Tmostly conserved

510Gmostly conserved

520Tmostly conserved

523Cmostly conserved

532Tmostly conserved

544Cmostly conserved

556Tmostly conserved

559Amostly conserved

568Cmostly conserved

578Tmostly conserved

580Gvariable

589Tmostly conserved

595Tmostly conserved

598Cvariable

601Tvariable

613Tmostly conserved

625Amostly conserved

628Tvariable

646Tmostly conserved

652Cvariable

653Cmostly conserved

658Cmostly conserved

AATACTATACTTTATTTTCGCAATATGAGCAGGAATAATTGGAGCTTCTCTTAGATTTATTATCCGAATAGAACTAAGAAATCCAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes14

BINs6

Most divergent pair9.4%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena merulasame genus9.3%Andrena testaceipessame genus11.7%Andrena igraecasame genus11.9%Andrena geraniisame genus12.3%Andrena fulvidasame genus12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type334 records

Wild obs. + sensor50

Museum / vouchered137

Other147

Origin

Native12

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 13≤1 km 5≤10 km 21>10 km 1

40 georeferenced · 10 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 14≤1 km 40≤10 km 58>10 km 9

121 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	43
Philadelphia, US	10
	9
Provincia di Livornolocation not on record	8
Coimbra, PT	7
Musee d'Histoire Naturallelocation not on record	4
Wuzhou, CN	4
Cambridge, US	2
PRAZlocation not on record	2
University of Florence, Department of Biologylocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
NMOKlocation not on record	1

12 institutions · 92 of 137 vouchered records shown · 45 without an institution code

09Environmental DNA15 detections

Where the DNA of Andrena hesperia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 11.9–17.3

Seasonal swing summer↔winter15.3 °C

Max temp (day)17.5 °C 15.1–19.7

Min temp (night)12.0 °C 9.20–13.9

Precipitation43.9 mm/mo 24.9–99.8

Air humidity55.4 % 54.9–58.4

Moisture balance-80.0 mm/mo

Vapour deficit777 Pa 581–882

Wind speed2.70 m/s

Cloud cover42.2 % 35.6–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)