Andrena florea

Fabricius, 1793 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records6 488

Data sources8

Biological traits1

DNA specimens44

eDNA detections35

Sources8 archives

Databases and archives Andrena florea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility6 488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF6 488 records

Environmental DNA1 datasets · 8 countries35 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT · NCBI≈252 Mbp

01Narrative

Die Zaunrüben-Sandbiene (Andrena florea) ist eine solitäre Wildbiene aus der Gattung der Sandbienen. Sie war die Wildbiene des Jahres 2015Wildbiene des Jahres 2015 - Wildbienen-Kataster [1].

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.43 mm

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena florea has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes2

eDNA detections35

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 71 variable positions, in barcode order

1Gmostly conserved

5Tmostly conserved

16Tmostly conserved

31Amostly conserved

34Tmostly conserved

38Gmostly conserved

40Tmostly conserved

43Gmostly conserved

49Amostly conserved

50Tmostly conserved

58Tmostly conserved

61Cmostly conserved

67Gmostly conserved

74Cmostly conserved

88Cmostly conserved

94Amostly conserved

112Tmostly conserved

124Cmostly conserved

130Cmostly conserved

133Amostly conserved

139Tmostly conserved

142Cmostly conserved

265Gmostly conserved

268Tmostly conserved

304Tmostly conserved

319Amostly conserved

331Amostly conserved

334Tmostly conserved

337Tmostly conserved

343Amostly conserved

346Amostly conserved

347Tmostly conserved

349Amostly conserved

358Tmostly conserved

364Tmostly conserved

367Tmostly conserved

373Amostly conserved

376Cmostly conserved

385Tmostly conserved

403Tmostly conserved

406Tmostly conserved

415Tmostly conserved

418Cmostly conserved

421Amostly conserved

433Tmostly conserved

439Cmostly conserved

451Cmostly conserved

458Tmostly conserved

494Tmostly conserved

502Amostly conserved

520Cmostly conserved

529Tmostly conserved

539Cmostly conserved

547Cmostly conserved

550Amostly conserved

553Cmostly conserved

556Tmostly conserved

557Cmostly conserved

562Cmostly conserved

571Tmostly conserved

577Gmostly conserved

578Tmostly conserved

589Cmostly conserved

592Tmostly conserved

598Amostly conserved

604Cmostly conserved

613Tmostly conserved

619Amostly conserved

628Gmostly conserved

640Tmostly conserved

646Tmostly conserved

GATATTATACTTCATTTTCGCTATATGAGCAGGTATAGTTGGGGCATCATTAAGATTTATCATCCGGATAGAACTAAGAAATCCAGGCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BINs2

Most divergent pair10.6%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena antonellaesame genus11.4%Andrena parathoracicasame genus11.9%Andrena bucephalasame genus12.3%Andrena argentatasame genus12.5%Andrena testaceipessame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Andrena florea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈251 794 254 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Andrena florea0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type6 488 records

Wild obs. + sensor5 101

Museum / vouchered1 220

Other167

Origin

Native448

Range

Area of Occupancy AOO7 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 848≤1 km 489≤10 km 3 073>10 km 17

4 427 georeferenced · 674 without coordinates

Open the mapobservation + sensor5 101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 7≤1 km 201≤10 km 821>10 km 24

1 053 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence1 220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ULglocation not on record	228
Provincia di Livornolocation not on record	117
Natural History Museum Rotterdamlocation not on record	64
Paro, BT	60
Bonn, DE	54
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	48
Zürich, CH	48
Coimbra, PT	48
NMOKlocation not on record	47
Bern, CH	46
Mons, BE	38
Musee d'Histoire Naturallelocation not on record	20
Wuzhou, CN	20
Cambridge, US	19
Natuurpuntlocation not on record	19
ZSMlocation not on record	18
Geneva, CH	16
PRAZlocation not on record	10
Bavarian State Collection of Zoologylocation not on record	8
	6
Mykotektet, National Veterinary Institutelocation not on record	6
PRUNlocation not on record	6
CBDClocation not on record	4
Museum zu Allerheiligen Schaffhausenlocation not on record	4
Uniwersytet Łódzkilocation not on record	4
Dhaka, BD	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Royal British Columbia Museumlocation not on record	4
Nijmegen, NL	3
Museu Nacional de História Natural e da Ciêncialocation not on record	3
AGClocation not on record	2
Tilburg, NL	2
South Kensington, GB	2
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	2
Philadelphia, US	2
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Champaign, US	2
Ghent, BE	1
Naturhistorisches Museum Wienlocation not on record	1
UMUlocation not on record	1
Ugentlocation not on record	1
Natural History Museum, Londonlocation not on record	1
MSVIlocation not on record	1

43 institutions · 996 of 1 220 vouchered records shown · 224 without an institution code

09Environmental DNA35 detections

Where the DNA of Andrena florea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map8 countries0

kiwifruit orchardMediterranean scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 12.4–17.6

Seasonal swing summer↔winter16.5 °C

Max temp (day)19.1 °C 16.7–22.0

Min temp (night)10.0 °C 7.70–13.3

Precipitation73.8 mm/mo 49.5–118

Air humidity59.4 % 57.4–60.6

Moisture balance-33.1 mm/mo -79.4–-1.50

Vapour deficit675 Pa 588–839

Wind speed2.90 m/s 2.10–3.70

Cloud cover35.7 % 32.0–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena florea

At a glance

Sources8 archives

Size & morphology1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 488 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 488 records