Andrena evoluta

Linsley & MacSwain, 1961 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records876

Data sources7

Biological traits1

DNA specimens29

eDNA detections43

Sources7 archives

Databases and archives Andrena evoluta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility876 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF876 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD29 specimens

01Narrative

The evolving miner bee (Andrena evoluta) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.99 mm

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena evoluta has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections43

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

88Tmostly conserved

154Tmostly conserved

206Tvariable

235Cmostly conserved

325Avariable

328Cmostly conserved

343Cmostly conserved

352Cmostly conserved

358Cvariable

412Gvariable

427Cmostly conserved

430Gmostly conserved

448Cvariable

539Tmostly conserved

559Amostly conserved

562Amostly conserved

628Avariable

TATATTATACTTTATTTTCGCAATATGAGCAGGAATAATTGGTGCTTCACTTAGATTTATTATTCGAATAGAATTAAGAAATCCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes9

BINs2

Most divergent pair5.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena ferrugineicrussame genus12.2%Andrena fulvidasame genus12.2%Andrena tridenssame genus12.2%Andrena senecionissame genus12.2%Andrena igraecasame genus12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type876 records

Museum / vouchered876

Range

Area of Occupancy AOO140 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 870 without coordinates

Open the institutions mapphysical evidence876

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	867
Champaign, US	5
	2
Vancouver, CA	1
WSUClocation not on record	1

5 institutions · 876 of 876 vouchered records shown

09Environmental DNA43 detections

Where the DNA of Andrena evoluta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 4.00–18.2

Seasonal swing summer↔winter21.0 °C

Max temp (day)18.6 °C 8.20–24.9

Min temp (night)5.00 °C -1.60–11.0

Precipitation58.3 mm/mo 27.7–128

Air humidity53.3 % 46.7–61.2

Moisture balance-61.2 mm/mo -113–20.7

Vapour deficit679 Pa 377–1,098

Wind speed2.70 m/s 1.90–3.60

Cloud cover39.0 % 34.8–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)