Andrena erythronii

Robertson, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records677

Data sources6

Biological traits1

DNA specimens8

eDNA detections0

Sources6 archives

Databases and archives Andrena erythronii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility677 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF677 records

DNA & barcodingBOLD8 specimens

01Narrative

Andrena erythronii is a species of miner bee native to eastern North America. It is known as the trout lily miner bee, trout-lily andrena, and trout lily bee, for its association with trout lilies, flowers in the genus Erythronium. It has also been observed visiting the flowers of other spring ephemerals such as spring beauty (Claytonia), hepatica (Hepatica), and harbinger-of-spring (Erigenia bulbosa), as well as spring-flowering shrubs and trees: serviceberry (Amelanchier), plum and cherry (Prunus), and willow (Salix). Female trout lily miner bees reach 11–14 mm in length while males are a little smaller: 9–11 mm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.2 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena erythronii has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

178Cvariable

442Cvariable

530Avariable

581Cvariable

628Tmostly conserved

AATATTATATTTTATCTTTGCAATATGAGCAGGAATAATTGGAGCATCCCTAAGATTTATTATTCGTATAGAATTAAGAAATCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena igraecasame genus10.0%Andrena panurgimorphasame genus10.3%Andrena caeruleasame genus10.9%Andrena erigeniaesame genus11.1%Andrena angustiorsame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type677 records

Wild obs. + sensor123

Museum / vouchered554

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 68≤1 km 26≤10 km 10>10 km 8

112 georeferenced · 11 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 55≤1 km 30≤10 km 143>10 km 15

243 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence554

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	147
	62
Cornell University Insect Collectionlocation not on record	53
White River Junction, US	49
Wuzhou, CN	34
University Park, US	24
US	21
St. Paul, US	20
WIlocation not on record	12
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	8
Saint John, CA	5
UNHClocation not on record	4
LULlocation not on record	3
Beltsville, US	2
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	2
Chicago, US	2
Middlebury Collegelocation not on record	1
Vermont Center for Ecostudieslocation not on record	1
Cambridge, US	1
New Haven, US	1

20 institutions · 452 of 554 vouchered records shown · 102 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)