Andrena chapmanae

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records263

Data sources7

Biological traits0

DNA specimens4

eDNA detections6

Sources7 archives

Databases and archives Andrena chapmanae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF263 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD4 specimens

01Narrative

The Chapman's miner bee (Andrena chapmanae) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena chapmanae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AATATTATACTTCATTTTCGCTATATGAGCAGGTATAATTGGAGCTTCTCTAAGATTCATTATTCGTATAGAACTAAGAAATCCTGGCAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena scurrasame genus8.8%Andrena montrosensissame genus9.4%Andrena mackieaesame genus10.0%Andrena viereckisame genus10.4%Andrena walleyisame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type263 records

Wild obs. + sensor1

Museum / vouchered243

Other19

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 26>10 km 4

30 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	183
Champaign, US	20
	12
Weber State University, Bird and Mammal Collectionlocation not on record	7
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	6
WSUClocation not on record	6
Wuzhou, CN	4
University of Alabamalocation not on record	3
OSUClocation not on record	1
Washington, US	1

10 institutions · 243 of 243 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Andrena chapmanae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 7.60–18.2

Seasonal swing summer↔winter24.9 °C

Max temp (day)17.3 °C 14.3–25.6

Min temp (night)4.40 °C 0.2–10.7

Precipitation23.9 mm/mo 21.6–36.8

Air humidity47.0 % 44.4–49.6

Moisture balance-96.7 mm/mo -130–-76.4

Vapour deficit873 Pa 562–1,128

Wind speed2.90 m/s 1.90–4.70

Cloud cover35.1 % 30.1–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)