Ancylometes rufus

(Walckenaer, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Ctenidae/Ancylometes

At a glance

Occurrence records1 013

Data sources8

Biological traits40

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Ancylometes rufus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 013 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

World Spider Trait DBMasaryk University40 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF1 013 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Die Riesenfischerspinne (Ancylometes rufus) ist eine Webspinne aus der Familie der Kammspinnen (Ctenidae). Die im nördlichen Südamerika verbreitete Art führt wie die anderen der Gattung Ancylometes eine bemerkenswerte und sehr aquatisch geprägte Lebensweise aus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aEggs et al. 2015Höfer & Brescovit 2000Moura & Azevedo 2011

Morphometry30

Abdomen length♀16.7·♂16.2 mm

Body length♀28.3·♂24.4 mm

Cephalothorax length♀9.75·♂18.8 mm

Cephalothorax width♀15.2·♂16 mm

Claw tuft area0 mm

Femur I length♀12.07·♂21 mm

Femur II length♀11.66·♂21 mm

Femur III length♀10.62·♂18 mm

Femur IV length♀13.14·♂23 mm

Leg I length♀46.8·♂87 mm

Leg II length♀39.35·♂82 mm

Leg III length♀37.95·♂72 mm

Leg IV length♀49.45·♂90 mm

Metatarsus I length♀8.94·♂24 mm

Metatarsus II length♀8.09·♂22 mm

Metatarsus III length♀8.98·♂21 mm

Metatarsus IV length♀14.29·♂24 mm

Patella I length♀5.31·♂9 mm

Patella II length♀5.21·♂9 mm

Patella III length♀4.0·♂8 mm

Patella IV length♀4.43·♂9 mm

Scopula cover0.431 mm

Tarsus I length♀5.38·♂10 mm

Tarsus II length♀4.91·♂9.5 mm

Tarsus III length♀5.33·♂9 mm

Tarsus IV length♀5.61·♂10.5 mm

Tibia I length♀15.1·♂21 mm

Tibia II length♀9.98·♂19.5 mm

Tibia III length♀8.52·♂17 mm

Tibia IV length♀11.96·♂21 mm

Predation7

Hunting guildambush hunters

Prey OrderAnura

Prey capturebite-and-release

Prey size♀13.8·♂13.85 mm

Prey stagehouse cricket (Acheta domesticus)

Strike speed0.45 mm

Web buildingNo

Physiology1

Venom toxicity0.426 mm

Defence1

Primary defenceAposematism

Morphology1

Spine number15 mm

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylometes rufus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P578 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

73Amostly conserved

111Amostly conserved

282Amostly conserved

309Tmostly conserved

400Amostly conserved

GTGTTGATTCGAATAGAGTTGGGTCATTCTGGAAGTTTGTTAGGAGATGATCATTTATATAATGTTGTGGTTACTGCTCATGCTTTCGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes4

BIN1

Most divergent pair0.69%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylometes bogotensissame genus10.0%Pirata alachuussame order11.4%Dolomedes plantariussame order11.8%Oxyopes licentisame order11.9%Pisaura lamasame order12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type1 013 records

Wild obs. + sensor184

Museum / vouchered822

Other7

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 52≤1 km 57≤10 km 29>10 km 11

149 georeferenced · 35 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 820 without coordinates

Open the institutions mapphysical evidence822

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Paraense Emílio Goeldilocation not on record	759
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	56
	4
Cambridge, US	2
Frankfurt am Main	1

5 institutions · 822 of 822 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Ancylometes rufus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylometes rufus

At a glance

Sources8 archives

Morphometry30

Predation7

Physiology1

Defence1

Morphology1

At a glance

Record type1 013 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 013 records