Ancylometes bogotensis

(Keyserling, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Ctenidae/Ancylometes

At a glance

Occurrence records766

Data sources8

Biological traits46

DNA specimens54

eDNA detections54

Sources8 archives

Databases and archives Ancylometes bogotensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility766 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

World Spider Trait DBMasaryk University46 traits · 5 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources46 traits

Occurrence & distributionGBIF766 records

Environmental DNA1 datasets · 1 countries54 detections

DNA & barcodingBOLD54 specimens

01Narrative

Die Wasserjagdspinne oder Fischerspinne (Ancylometes bogotensis) ist eine Webspinne aus der Familie der Kammspinnen (Ctenidae). Sie kommt in Zentral- und Südamerika vor und sollte nicht mit der in Neuseeland ebenfalls am und im Wasser lebenden Jagdspinne Dolomedes aquaticus verwechselt werden.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWolff et al. 2022Cambra et al. 2004Merrett 1988Höfer & Brescovit 2000Pickard-Cambridge 1897

Morphometry41

ALE0.34 mm

AME0.5 mm

Abdomen height5.6 mm

Abdomen length12.95 mm

Body length25.4 mm

Cephalothorax height5.34 mm

Cephalothorax length12.5 mm

Cephalothorax width9.8 mm

Chelicerae basal part (paturon) length4.01 mm

Fang length2.81 mm

Femur I length10.4 mm

Femur I width2.86 mm

Femur II length10.1 mm

Femur III length9 mm

Femur IV length11.1 mm

Femur IV width2.53 mm

Leg I length36.8 mm

Leg II length36 mm

Leg III length34 mm

Leg IV length46 mm

Metatarsus I length7.2 mm

Metatarsus II length7.4 mm

Metatarsus III length8.1 mm

Metatarsus IV length12.6 mm

PLE0.58 mm

PME0.6 mm

Patella I length4.9 mm

Patella II length5.2 mm

Patella III length5 mm

Patella IV length4.3 mm

Spinneret PLS1.4 mm

Tarsus I length3.9 mm

Tarsus II length4.1 mm

Tarsus III length3.7 mm

Tarsus IV length4.85 mm

Tibia I length8.8 mm

Tibia I width1.5 mm

Tibia II length8.5 mm

Tibia III length7.6 mm

Tibia IV length9.4 mm

Tibia IV width1.22 mm

Predation2

Hunting guild 2ground runner

Web buildingno

Biomechanics1

'Primary mode of locomotionwalking

Defence1

PredatorEntypus urichi

Morphology1

Cribellumabsent

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylometes bogotensis has left across the world's sequence archives.

At a glance

DNA specimens54

BINs11

Marker genes3

eDNA detections54

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P578 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

3Amostly conserved

12Tvariable

21Amostly conserved

28Tmostly conserved

45Gmostly conserved

51Tmostly conserved

69Gmostly conserved

108Amostly conserved

111Avariable

120Amostly conserved

126Tmostly conserved

142Tmostly conserved

157Cvariable

174Amostly conserved

186Amostly conserved

189Gmostly conserved

201Avariable

210Gvariable

216Cvariable

237Tmostly conserved

240Amostly conserved

243Avariable

258Gvariable

261Avariable

264Gvariable

267Amostly conserved

279Gvariable

285Tmostly conserved

288Tmostly conserved

294Amostly conserved

297Tvariable

301Amostly conserved

309Amostly conserved

318Avariable

324Amostly conserved

357Amostly conserved

378Gmostly conserved

411Gvariable

417Gvariable

423Gmostly conserved

426Amostly conserved

432Avariable

447Avariable

456Amostly conserved

483Gmostly conserved

486Gmostly conserved

489Amostly conserved

495Amostly conserved

498Amostly conserved

501Avariable

516Tmostly conserved

525Gvariable

537Avariable

540Tvariable

561Tmostly conserved

573Gvariable

576Avariable

GTATTGATTCGTATGGAGTTAGGTCATTCTGGAAGTTTATTAGGGGATGATCATTTATATAATGTTGTGGTTACTGCTCATGCTTTTGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes29

BINs11

Most divergent pair11.1%

OtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cupiennius chiapanensissame order9.7%Ancylometes rufussame genus10.0%Oxyopes sertatussame order10.7%Oxyopes lineatipessame order10.9%Oxyopes javanussame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type766 records

Wild obs. + sensor632

Museum / vouchered131

Other3

Range

Area of Occupancy AOO1 736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 273≤1 km 158≤10 km 58>10 km 38

527 georeferenced · 105 without coordinates

Open the mapobservation + sensor632

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 8≤10 km 39>10 km 24

71 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	61
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	28
Universidad de La Salle (La Salle)location not on record	25
Cambridge, US	10
Tapachula, MX	4
National Biodiversity Institute, Costa Ricalocation not on record	1
Albuquerque, US	1
Instituto Amazónico de Investigaciones Científicas SINCHI Colección Anfibioslocation not on record	1

8 institutions · 131 of 131 vouchered records shown

09Environmental DNA54 detections

Where the DNA of Ancylometes bogotensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)30.0 °C

Min temp (night)22.3 °C

Precipitation201 mm/mo

Air humidity65.4 %

Moisture balance66.9 mm/mo

Vapour deficit1,144 Pa

Wind speed1.20 m/s

Cloud cover30.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)