Ancylis unculana

(Haworth, 1811) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records3 038

Data sources10

Biological traits2

DNA specimens42

eDNA detections41

Sources10 archives

Databases and archives Ancylis unculana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 038 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 038 records

Environmental DNA2 datasets · 9 countries41 detections

DNA & barcodingBOLD42 specimens

Genome at a glanceGoaT · NCBI≈571 Mbp

01Narrative

Ancylis unculana is a moth belonging to the family Tortricidae. The species was first described by Adrian Hardy Haworth in 1811. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis unculana has left across the world's sequence archives.

At a glance

DNA specimens42

BINs3

Marker genes1

eDNA detections41

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

10Tvariable

23Avariable

34Avariable

40Amostly conserved

58Amostly conserved

59Cmostly conserved

118Tvariable

124Tvariable

133Tmostly conserved

166Gmostly conserved

220Cvariable

232Cvariable

262Amostly conserved

268Cmostly conserved

271Tvariable

355Tmostly conserved

385Tmostly conserved

386Tvariable

433Amostly conserved

457Cvariable

505Cvariable

506Gvariable

514Avariable

520Cvariable

538Amostly conserved

562Gvariable

578Cvariable

616Tmostly conserved

622Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes12

BINs3

Most divergent pair8.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis fuscocilianasame genus6.1%Ancylis lacinianasame genus6.1%Ancylis columbianasame genus6.1%Ancylis discigeranasame genus6.2%Ancylis burgessianasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ancylis unculana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈570 713 300 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ancylis unculana0.57 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.4% BUSCO

08Occurrence & distribution

Record type3 038 records

Wild obs. + sensor2 582

Museum / vouchered370

Other86

Range

Area of Occupancy AOO5 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 696≤1 km 363≤10 km 1 347>10 km 6

2 412 georeferenced · 170 without coordinates

Open the mapobservation + sensor2 582

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 61≤1 km 146≤10 km 72>10 km 1

280 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	104
Provincia di Livornolocation not on record	76
Tartu, EE	33
NHMOlocation not on record	23
SLU Artdatabankenlocation not on record	23
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	15
Kuopio, FI	9
Nijmegen, NL	8
Philadelphia, US	7
Research Collection of Alfred Haslbergerlocation not on record	3
Rovaniemi, FI	3
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Research Collection of Theo Gruenewaldlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Research Collection of Richard Heindellocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
Stockholm, SE	1
Helsinki, FI	1
University of Kaiserslauternlocation not on record	1
South Kensington, GB	1
Durban Natural Science Museumlocation not on record	1
Iwate Prefectural Museumlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Salzburg, AT	1

26 institutions · 323 of 370 vouchered records shown · 47 without an institution code

09Environmental DNA41 detections

Where the DNA of Ancylis unculana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys2

Countries9

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 6.90–18.9

Seasonal swing summer↔winter19.1 °C

Max temp (day)18.5 °C 11.0–23.2

Min temp (night)9.40 °C 1.50–14.5

Precipitation80.4 mm/mo 55.2–209

Air humidity59.8 % 57.5–65.4

Moisture balance-29.1 mm/mo -57.5–99.8

Vapour deficit668 Pa 375–911

Wind speed3.10 m/s 1.60–4.90

Cloud cover39.0 % 33.7–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylis unculana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 038 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 038 records