Ancylis subaequana

(Zeller, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records378

Data sources7

Biological traits0

DNA specimens78

eDNA detections32

Sources7 archives

Databases and archives Ancylis subaequana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility378 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF378 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD78 specimens

01Narrative

Ancylis subaequana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1875 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis subaequana has left across the world's sequence archives.

At a glance

DNA specimens78

BINs8

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

22Amostly conserved

38Gmostly conserved

49Cmostly conserved

82Tvariable

97Tvariable

112Tmostly conserved

127Cvariable

133Cmostly conserved

160Amostly conserved

166Amostly conserved

169Cmostly conserved

205Tvariable

206Cmostly conserved

259Tmostly conserved

271Amostly conserved

274Tmostly conserved

284Tmostly conserved

286Avariable

287Tmostly conserved

302Avariable

313Cmostly conserved

322Amostly conserved

358Tmostly conserved

364Cmostly conserved

367Cmostly conserved

370Tmostly conserved

385Tmostly conserved

397Cmostly conserved

400Amostly conserved

406Cmostly conserved

421Tvariable

433Gvariable

445Tmostly conserved

448Cmostly conserved

457Cvariable

463Tmostly conserved

481Avariable

484Avariable

499Amostly conserved

536Cmostly conserved

538Amostly conserved

557Cmostly conserved

562Amostly conserved

571Cvariable

574Tmostly conserved

586Gvariable

589Cmostly conserved

607Cmostly conserved

619Tmostly conserved

628Tmostly conserved

634Cmostly conserved

640Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCCTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes23

BINs8

Most divergent pair8.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis myrtillanasame genus1.8%Ancylis albacostanasame genus6.2%Ancylis maritimasame genus7.1%Ancylis badianasame genus7.3%Ancylis apicellasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type378 records

Wild obs. + sensor179

Museum / vouchered199

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 110≤1 km 18≤10 km 4>10 km 15

147 georeferenced · 32 without coordinates

Open the mapobservation + sensor179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 2≤1 km 10≤10 km 14>10 km 20

46 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	64
East Lansing, US	33
North Carolina State University Insect Museumlocation not on record	28
St. Paul, US	21
New Haven, US	11
Royal Saskatchewan Museumlocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
San Francisco, US	2
Mississippi State, US	1
Centre for Biodiversity Genomicslocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

11 institutions · 182 of 199 vouchered records shown · 17 without an institution code

09Environmental DNA32 detections

Where the DNA of Ancylis subaequana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1. Boreal ForestGrasslandMixed habitatTemperate mixed forestRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 9.10–18.7

Seasonal swing summer↔winter30.9 °C

Max temp (day)20.2 °C 13.7–23.6

Min temp (night)10.5 °C 5.30–14.2

Precipitation88.9 mm/mo 74.0–116

Air humidity58.9 % 55.3–62.6

Moisture balance-31.1 mm/mo -62.3–3.10

Vapour deficit733 Pa 461–902

Wind speed3.10 m/s 2.30–5.30

Cloud cover44.3 % 40.4–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)