Ancistrocerus claripennis

Thomson, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records4 328

Data sources6

Biological traits2

DNA specimens26

eDNA detections24

Sources6 archives

Databases and archives Ancistrocerus claripennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 328 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 328 records

Environmental DNA1 datasets · 6 countries24 detections

DNA & barcodingBOLD26 specimens

01Narrative

Ancistrocerus claripennis is een vliesvleugelig insect uit de familie van de plooivleugelwespen (Vespidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Thomson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus claripennis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs3

Marker genes2

eDNA detections24

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

2Cmostly conserved

16Cmostly conserved

31Cmostly conserved

34Amostly conserved

43Gvariable

50Cmostly conserved

52Tmostly conserved

67Tmostly conserved

82Cmostly conserved

100Amostly conserved

181Tmostly conserved

232Cmostly conserved

238Cmostly conserved

256Gmostly conserved

271Cmostly conserved

274Cmostly conserved

277Cmostly conserved

289Cmostly conserved

310Cmostly conserved

356Gvariable

389Gmostly conserved

403Gmostly conserved

412Amostly conserved

418Amostly conserved

421Tmostly conserved

508Cmostly conserved

526Tmostly conserved

565Gmostly conserved

571Cmostly conserved

577Gmostly conserved

589Cmostly conserved

598Cmostly conserved

613Cmostly conserved

628Tmostly conserved

652Tmostly conserved

TCTACTTTATTTTATCTTTGGAATTTGATCCGGAATAATTGGGTCAGCTCTTAGAATAATTATTCGTTTAGAACTTGGAACCCCAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes6

BINs3

Most divergent pair12.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus trifasciatussame genus6.4%Ancistrocerus longispinosussame genus6.8%Ancistrocerus scoticussame genus8.4%Ancistrocerus gazellasame genus8.4%Ancistrocerus albophaleratussame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 328 records

Wild obs. + sensor438

Museum / vouchered3 822

Cultivated / captive1

Other67

Origin

Native604

Range

Area of Occupancy AOO5 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 126≤1 km 146≤10 km 140>10 km 4

416 georeferenced · 22 without coordinates

Open the mapobservation + sensor438

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 198≤1 km 843≤10 km 2 414>10 km 80

3 535 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence3 822

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 336
Provincia di Livornolocation not on record	567
Zürich, CH	293
Paro, BT	205
Bern, CH	199
Muzeum Górnośląskie w Bytomiulocation not on record	175
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	141
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	131
Philadelphia, US	105
Geneva, CH	65
SLU Artdatabankenlocation not on record	61
Natural History Museum Rotterdamlocation not on record	35
ZMAAlocation not on record	32
Dhaka, BD	22
NMOKlocation not on record	21
Musee d'Histoire Naturallelocation not on record	20
Frauenfeld, CH	19
Tartu, EE	12
Bonn, DE	12
Gothenburg, SE	9
Stockholm, SE	8
Universität Zürich, Naturhistorisches Museumlocation not on record	8
Tilburg, NL	8
ZSMlocation not on record	5
Metsähallituslocation not on record	4
Tallinn, EE	3
MZLUlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Ghent, BE	1
Naturmuseum Solothurnlocation not on record	1

30 institutions · 3 501 of 3 822 vouchered records shown · 321 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA24 detections

Where the DNA of Ancistrocerus claripennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 9.60–19.0

Seasonal swing summer↔winter18.8 °C

Max temp (day)19.1 °C 12.7–22.9

Min temp (night)12.4 °C 3.90–14.5

Precipitation80.4 mm/mo 72.2–105

Air humidity59.0 % 57.3–61.6

Moisture balance-38.8 mm/mo -65.1–12.0

Vapour deficit740 Pa 507–927

Wind speed3.30 m/s 2.50–5.10

Cloud cover44.4 % 35.5–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancistrocerus claripennis

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type4 328 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 328 records