Ancistrocerus biphaleratus

(de Saussure, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records248

Data sources6

Biological traits0

DNA specimens3

eDNA detections1

Sources6 archives

Databases and archives Ancistrocerus biphaleratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility248 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF248 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD3 specimens

01Narrative

Ancistrocerus biphaleratus is een vliesvleugelig insect uit de familie van de plooivleugelwespen (Vespidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Saussure.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus biphaleratus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BINs2

Most divergent pair3.0%

Where individuals differ — all 19 variable positions, in barcode order

94Cvariable

100Cvariable

223Tvariable

241Gvariable

253Avariable

259Tvariable

277Cvariable

281Avariable

319Tvariable

370Tvariable

445Cvariable

448Tvariable

451Tvariable

454Gvariable

493Tvariable

518Cvariable

583Tvariable

589Cvariable

610Tvariable

TTGATCAGGAATAATTGGTTCAGCTTTAAGAATAATCATTCGATTAGAATTAGGAACCCCAGGTAAATTAATTGGAAATGACCAAATTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus longispinosussame genus8.0%Ancistrocerus trifasciatussame genus8.2%Ancistrocerus gazellasame genus8.5%Ancistrocerus oviventrissame genus9.0%Ancistrocerus adiabatussame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type248 records

Wild obs. + sensor180

Museum / vouchered68

Origin

Native4

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 9≤1 km 9>10 km 3

21 georeferenced · 159 without coordinates

Open the mapobservation + sensor180

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 17≤10 km 44>10 km 7

68 georeferenced

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	66
IMEDEAlocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

3 institutions · 68 of 68 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ancistrocerus biphaleratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 18.1–18.1

Seasonal swing summer↔winter13.7 °C

Max temp (day)19.0 °C

Min temp (night)17.0 °C

Precipitation28.0 mm/mo

Air humidity64.3 %

Moisture balance-118 mm/mo

Vapour deficit738 Pa

Wind speed3.00 m/s

Cloud cover42.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)