Anchomenus funebris

(LeConte, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Anchomenus

At a glance

Occurrence records688

Data sources7

Biological traits0

DNA specimens16

eDNA detections20

Sources7 archives

Databases and archives Anchomenus funebris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility688 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF688 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anchomenus funebris is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchomenus funebris has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

58Gvariable

79Gvariable

163Tmostly conserved

289Tvariable

322Gvariable

370Avariable

430Amostly conserved

499Cvariable

508Tvariable

AACTTTATACTTTATTTTTGGTGCATGATCAGGAATAGTAGGAACTTCATTAAGAATGTTAATTCGAGCTGAATTAGGGAACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes4

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agonum erranssame family3.0%Agonum ferreumsame family3.8%Agonum extensicollesame family5.0%Agonum decorumsame family5.5%Agonum striatopunctatumsame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type688 records

Wild obs. + sensor31

Museum / vouchered657

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 10≤1 km 8≤10 km 1>10 km 3

22 georeferenced · 9 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 5≤1 km 20≤10 km 54>10 km 3

82 georeferenced · 575 without coordinates

Open the institutions mapphysical evidence657

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	447
Santa Barbara Museum of Natural Historylocation not on record	132
Essig Museum of Entomologylocation not on record	27
Provo, US	26
University of Alabamalocation not on record	14
Champaign, US	5
Colorado State Universitylocation not on record	3
EWIClocation not on record	2
US	1

9 institutions · 657 of 657 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Anchomenus funebris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 5.70–18.5

Seasonal swing summer↔winter13.4 °C

Max temp (day)15.4 °C 11.2–24.2

Min temp (night)11.1 °C 1.50–15.0

Precipitation10.0 mm/mo 2.00–203

Air humidity58.6 % 51.7–65.0

Moisture balance-59.2 mm/mo -148–155

Vapour deficit546 Pa 446–881

Wind speed1.90 m/s 1.50–5.70

Cloud cover27.3 % 17.4–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)