Agonum errans

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records649

Data sources8

Biological traits0

DNA specimens12

eDNA detections8

Sources8 archives

Databases and archives Agonum errans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility649 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF649 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceTreeOfSex2n = 38

01Narrative

Agonum errans is a species of ground beetle from Platyninae subfamily, that can be found in North Dakota, United States and Alberta, Canada.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum errans has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

51Tmostly conserved

55Tvariable

82Cmostly conserved

119Gmostly conserved

138Cmostly conserved

157Cmostly conserved

175Gmostly conserved

184Amostly conserved

202Tmostly conserved

214Gmostly conserved

240Gmostly conserved

250Tmostly conserved

271Cmostly conserved

286Amostly conserved

295Amostly conserved

325Amostly conserved

331Amostly conserved

343Tmostly conserved

347Tmostly conserved

433Amostly conserved

439Amostly conserved

500Cmostly conserved

508Amostly conserved

517Gmostly conserved

542Cmostly conserved

548Cmostly conserved

557Tmostly conserved

578Cmostly conserved

593Amostly conserved

602Amostly conserved

610Tmostly conserved

616Cmostly conserved

619Amostly conserved

634Cmostly conserved

AACTTTATACTTTATTTTTGGTGCATGATCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCTGAATTAGGAAACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BINs2

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchomenus funebrissame family3.0%Agonum ferreumsame genus4.0%Agonum extensicollesame genus4.9%Agonum decorumsame genus5.0%Agonum striatopunctatumsame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Agonum errans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×TreeOfSex · invert

TreeOfSex · invert — Serrano J, Yadav JS (1984) Chromosome numbers and sex-determining mechanisms in adephagan Coleoptera. Coleopt Bull 38: 335-357. ↗

08Occurrence & distribution

Record type649 records

Wild obs. + sensor7

Museum / vouchered642

Range

Area of Occupancy AOO552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 4

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 5≤1 km 3≤10 km 16>10 km 9

33 georeferenced · 609 without coordinates

Open the institutions mapphysical evidence642

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	481
Royal Saskatchewan Museumlocation not on record	43
WIlocation not on record	36
OSUClocation not on record	23
Espace pour la vielocation not on record	12
College Station, US	10
Saint John, CA	7
University of Alabamalocation not on record	6
Tempe, US	6
Provo, US	5
Colorado State Universitylocation not on record	4
Universidad Católica de Manizaleslocation not on record	3
Decorah, US	2
University of Guelphlocation not on record	2
München, DE	1
Essig Museum of Entomologylocation not on record	1

16 institutions · 642 of 642 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Agonum errans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

emergentHerbaceousWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 6.00–20.4

Seasonal swing summer↔winter32.5 °C

Max temp (day)23.0 °C 11.0–26.2

Min temp (night)12.7 °C 1.30–16.0

Precipitation90.8 mm/mo 79.2–101

Air humidity57.8 % 56.1–59.7

Moisture balance-63.5 mm/mo -83.3–-18.1

Vapour deficit842 Pa 421–1,011

Wind speed5.00 m/s 4.50–5.80

Cloud cover37.4 % 32.0–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)