Agonum ferreum

Haldeman, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Agonum

At a glance

Occurrence records120

Data sources7

Biological traits0

DNA specimens24

eDNA detections24

Sources7 archives

Databases and archives Agonum ferreum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF120 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Agonum ferreum is a species of ground beetle from Platyninae subfamily, that can be found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agonum ferreum has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

10Cmostly conserved

25Amostly conserved

40Tmostly conserved

88Gmostly conserved

223Cmostly conserved

235Cmostly conserved

265Amostly conserved

278Cmostly conserved

316Gmostly conserved

340Tmostly conserved

343Cmostly conserved

355Tmostly conserved

358Tmostly conserved

370Gmostly conserved

406Tmostly conserved

415Amostly conserved

508Amostly conserved

557Tmostly conserved

616Cmostly conserved

622Amostly conserved

631Amostly conserved

AACTTTATACTTTATTTTTGGTGCATGATCAGGAATAGTTGGAACTTCATTAAGAATATTAATTCGAGCTGAATTAGGAAATCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes9

BINs2

Most divergent pair12.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchomenus quadratussame family3.2%Anchomenus funebrissame family3.8%Agonum erranssame genus4.0%Agonum extensicollesame genus4.6%Agonum decorumsame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type120 records

Wild obs. + sensor14

Museum / vouchered106

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 8≤1 km 5≤10 km 1

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 33≤1 km 1≤10 km 10>10 km 4

48 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	35
OSUClocation not on record	33
University of Alberta Museums (UAM)location not on record	9
Provo, US	7
CUlocation not on record	5
University of Alabamalocation not on record	4
Cambridge, US	3
University Park, US	3
University of Guelphlocation not on record	2
EWIClocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1
UDlocation not on record	1

12 institutions · 105 of 106 vouchered records shown · 1 without an institution code

09Environmental DNA24 detections

Where the DNA of Agonum ferreum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

Mixed habitatdeciduousForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.7–23.3

Seasonal swing summer↔winter24.1 °C

Max temp (day)22.7 °C 17.0–28.6

Min temp (night)11.6 °C 6.40–18.5

Precipitation97.2 mm/mo 89.3–117

Air humidity56.7 % 54.2–58.5

Moisture balance-25.9 mm/mo -67.8–1.50

Vapour deficit853 Pa 654–1,223

Wind speed3.10 m/s 2.60–3.80

Cloud cover41.2 % 31.9–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)