Anchinia cristalis

Scopoli, 1763 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Anchinia

At a glance

Occurrence records273

Data sources7

Biological traits0

DNA specimens26

eDNA detections1

Sources7 archives

Databases and archives Anchinia cristalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD26 specimens

01Narrative

Anchinia cristalis is a species of moth of the family Depressariidae. It is found in most of Europe (except most of the Balkan Peninsula, Portugal, Great Britain, Ireland, the Netherlands, Norway, Finland, and Ukraine) east to the eastern parts of the Palearctic realm. The wingspan is 14–19 mm. Adults are on wing from late May to early July. The larvae live between spun leaves of Thymelaea passerina, Daphne mezereum and Daphne laureola.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchinia cristalis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes1

eDNA detections1

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

202Gmostly conserved

277Cmostly conserved

616Cmostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes7

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchinia grisescenssame genus6.2%Anchinia daphnellasame genus6.4%Anchinia grandissame genus6.9%Glaucocharis ochracealissame order9.4%Achaea catellasame order9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type273 records

Wild obs. + sensor101

Museum / vouchered115

Other57

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 20≤1 km 42≤10 km 11

73 georeferenced · 28 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 11≤1 km 82≤10 km 7

100 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	64
Salzburg, AT	24
Tartu, EE	10
European Distributed Institute of Taxonomy (EDIT)location not on record	4
ZSMlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
NHMOlocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1

10 institutions · 111 of 115 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Anchinia cristalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter19.1 °C

Max temp (day)21.1 °C

Min temp (night)12.0 °C

Precipitation68.3 mm/mo

Air humidity58.2 %

Moisture balance-54.8 mm/mo

Vapour deficit806 Pa

Wind speed3.20 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)