Anchinia daphnella

Hübner, 1801 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Anchinia

At a glance

Occurrence records1 394

Data sources7

Biological traits0

DNA specimens31

eDNA detections16

Sources7 archives

Databases and archives Anchinia daphnella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 394 records

Environmental DNA1 datasets · 4 countries16 detections

DNA & barcodingBOLD31 specimens

01Narrative

Anchinia daphnella is a species of moth of the family Depressariidae. It is found in most of Europe, except the Iberian Peninsula, Great Britain, Ireland, the Benelux and Greece. In the east, the range extends to the eastern part of the Palearctic realm. The wingspan is 23–26 mm.Swedish Moths The larvae feed on Daphne mezereum.Anchinia at funet

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchinia daphnella has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes2

eDNA detections16

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

68Amostly conserved

79Tvariable

218Gmostly conserved

226Tmostly conserved

283Tmostly conserved

295Avariable

379Cvariable

401Tvariable

553Amostly conserved

562Avariable

578Tvariable

598Tmostly conserved

646Cvariable

652Cvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes7

BINs2

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchinia grisescenssame genus3.8%Anchinia grandissame genus6.3%Anchinia cristalissame genus6.4%Anchinia laureolellasame genus6.4%Protesilaus macrosilaussame order7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 394 records

Wild obs. + sensor671

Museum / vouchered682

Other41

Range

Area of Occupancy AOO1 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 292≤1 km 168≤10 km 186>10 km 4

650 georeferenced · 21 without coordinates

Open the mapobservation + sensor671

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 40≤1 km 131≤10 km 448>10 km 24

643 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence682

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	512
Provincia di Livornolocation not on record	41
Tartu, EE	32
NHMOlocation not on record	22
Salzburg, AT	10
European Distributed Institute of Taxonomy (EDIT)location not on record	8
Kuopio, FI	8
Philadelphia, US	7
SLU Artdatabankenlocation not on record	5
ZSMlocation not on record	2
DABUHlocation not on record	2
ZMAAlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
RMZlocation not on record	1
NTNU-VMlocation not on record	1
Stockholm, SE	1
Bavarian State Collection of Zoologylocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1

18 institutions · 657 of 682 vouchered records shown · 25 without an institution code

09Environmental DNA16 detections

Where the DNA of Anchinia daphnella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 4.50–17.5

Seasonal swing summer↔winter20.0 °C

Max temp (day)17.5 °C 7.30–21.9

Min temp (night)7.80 °C 1.50–12.3

Precipitation75.6 mm/mo 52.4–224

Air humidity61.7 % 54.5–65.8

Moisture balance9.70 mm/mo -107–100

Vapour deficit566 Pa 375–904

Wind speed2.40 m/s 1.10–3.60

Cloud cover37.6 % 34.6–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anchinia daphnella

At a glance

Sources7 archives

At a glance

Record type1 394 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 394 records