Anastrangalia laetifica

(LeConte, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anastrangalia

At a glance

Occurrence records1 647

Data sources7

Biological traits0

DNA specimens32

eDNA detections23

Sources7 archives

Databases and archives Anastrangalia laetifica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 647 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 647 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD32 specimens

01Narrative

Anastrangalia laetifica is a species of beetle from family Cerambycidae found in Canada, United States, and Mexico. The males are all black, while the females have 4 black dots on their red coloured elytra. They feed on Frasera albicaulis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrangalia laetifica has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

28Amostly conserved

82Cvariable

85Tvariable

103Cmostly conserved

106Cmostly conserved

181Gmostly conserved

190Tvariable

202Tmostly conserved

214Avariable

235Tmostly conserved

271Amostly conserved

278Cvariable

280Amostly conserved

298Gmostly conserved

347Tvariable

355Tvariable

373Gvariable

397Cvariable

451Tmostly conserved

478Gvariable

508Cmostly conserved

511Gvariable

538Tmostly conserved

643Cmostly conserved

TACTTTATATTTTATTTTTGGAGCTTGAGCGAGAATAGTAGGAACTTCATTAAGACTTTTAATTCGTTCTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes16

BIN1

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrangalia dubiasame genus10.5%Anastrangalia reyisame genus10.6%Anastrangalia sequensisame genus10.8%Stictoleptura rubrasame family12.2%Anastrangalia sanguinolentasame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 647 records

Wild obs. + sensor1 344

Museum / vouchered303

Range

Area of Occupancy AOO3 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 647≤1 km 148≤10 km 81>10 km 80

956 georeferenced · 388 without coordinates

Open the mapobservation + sensor1 344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 4≤1 km 6≤10 km 29>10 km 10

49 georeferenced · 254 without coordinates

Open the institutions mapphysical evidence303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	202
Santa Barbara Museum of Natural Historylocation not on record	40
San Diego, US	36
WIlocation not on record	8
University of Alberta Museums (UAM)location not on record	3
California Academy of Scienceslocation not on record	2
Natural History Museum of Utahlocation not on record	2
University of Central Floridalocation not on record	2
Santa Cruz, US	2
Lexington, US	2
CUlocation not on record	1
Albuquerque, US	1
Saint John, CA	1
Essig Museum of Entomologylocation not on record	1

14 institutions · 303 of 303 vouchered records shown

09Environmental DNA23 detections

Where the DNA of Anastrangalia laetifica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestPseudoroegneria grassland with Stipa comata,…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 14.3–19.6

Seasonal swing summer↔winter21.1 °C

Max temp (day)23.9 °C 21.9–27.6

Min temp (night)9.20 °C 7.40–12.7

Precipitation35.7 mm/mo 6.00–56.0

Air humidity48.2 % 38.9–53.5

Moisture balance-123 mm/mo -183–-70.9

Vapour deficit1,018 Pa 865–1,326

Wind speed2.50 m/s 1.90–3.20

Cloud cover38.0 % 19.1–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anastrangalia laetifica

At a glance

Sources7 archives

At a glance

Record type1 647 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 647 records