Anastrangalia dubia

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anastrangalia

At a glance

Occurrence records4 441

Data sources7

Biological traits0

DNA specimens73

eDNA detections1

Sources7 archives

Databases and archives Anastrangalia dubia's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 441 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 441 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD73 specimens

01Narrative

Anastrangalia dubia is a species of beetle of family Cerambycidae. Anastrangalia dubia, male

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrangalia dubia has left across the world's sequence archives.

At a glance

DNA specimens73

BINs1

Marker genes1

eDNA detections1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus72 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

22Gvariable

271Amostly conserved

370Cvariable

448Tmostly conserved

478Amostly conserved

496Amostly conserved

565Avariable

619Gvariable

625Gmostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGGGCTTGGGCAAGAATAGTAGGAACATCCTTAAGACTCCTAATTCGTTCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes27

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrangalia sequensisame genus2.6%Anastrangalia laetificasame genus10.5%Stictoleptura rubrasame family10.8%Stictoleptura canadensissame family12.2%Leptura annularissame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 441 records

Wild obs. + sensor3 576

Museum / vouchered455

Fossil3

Other407

Range

Area of Occupancy AOO8 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 693≤1 km 374≤10 km 1 611>10 km 90

2 768 georeferenced · 808 without coordinates

Open the mapobservation + sensor3 576

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 10≤1 km 65≤10 km 164>10 km 16

255 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence455

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Łódzkilocation not on record	66
Salzburg, AT	51
Muzeum Górnośląskie w Bytomiulocation not on record	40
Dhaka, BD	27
Helsinki, FI	18
NMOKlocation not on record	14
Nijmegen, NL	13
European Distributed Institute of Taxonomy (EDIT)location not on record	12
Vitoria, ES	11
Tartu, EE	9
Natural History Museum Rotterdamlocation not on record	9
South Kensington, GB	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	7
Philadelphia, US	5
Provincia di Livornolocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	5
ZSMlocation not on record	4
Tilburg, NL	3
University Park, US	3
Brussels, BE	3
Winterthur, CH	2
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	1

22 institutions · 316 of 455 vouchered records shown · 139 without an institution code

09Environmental DNA1 detections

Where the DNA of Anastrangalia dubia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.60 °C 6.60–6.60

Seasonal swing summer↔winter19.7 °C

Max temp (day)10.1 °C

Min temp (night)2.20 °C

Precipitation77.0 mm/mo

Air humidity63.2 %

Moisture balance16.9 mm/mo

Vapour deficit407 Pa

Wind speed3.30 m/s

Cloud cover42.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anastrangalia dubia

At a glance

Sources7 archives

At a glance

Record type4 441 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 441 records