Anaspis fasciata

(Forster, 1771) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records2 676

Data sources6

Biological traits0

DNA specimens8

eDNA detections21

Sources6 archives

Databases and archives Anaspis fasciata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 676 records

Environmental DNA2 datasets · 5 countries21 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anaspis fasciata is een keversoort uit de familie bloemspartelkevers (Scraptiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1771 door Forster.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis fasciata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections21

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTCTTTATTTCATCTTTGGAGCATGATCAGGTATAGTAGGAACTTCCCTCAGCCTACTAATTCGATCAGAACTCGGAACTCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis flavasame genus12.5%Anaspis costaisame genus13.4%Anaspis melanostomasame genus13.4%Anaspis arcticasame genus13.8%Anaspis kiesenwetterisame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 676 records

Wild obs. + sensor2 271

Museum / vouchered79

Other326

Range

Area of Occupancy AOO5 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 880≤1 km 508≤10 km 683>10 km 23

2 094 georeferenced · 177 without coordinates

Open the mapobservation + sensor2 271

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 11≤1 km 31≤10 km 15

57 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tilburg, NL	28
South Kensington, GB	10
Natural History Museum Rotterdamlocation not on record	5
CBDClocation not on record	4
Natural History Museum, Londonlocation not on record	3
NCMGlocation not on record	3
SLU Artdatabankenlocation not on record	3
Naturalis Biodiversity Centerlocation not on record	1

8 institutions · 57 of 79 vouchered records shown · 22 without an institution code

09Environmental DNA21 detections

Where the DNA of Anaspis fasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map5 countries0

Olive orchardaus der Krautschicht gekeschert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 11.0–17.0

Seasonal swing summer↔winter14.0 °C

Max temp (day)17.9 °C 14.6–21.2

Min temp (night)9.60 °C 7.00–11.7

Precipitation56.1 mm/mo 50.5–74.1

Air humidity60.3 % 58.9–61.3

Moisture balance-48.4 mm/mo -70.9–-23.9

Vapour deficit650 Pa 515–807

Wind speed3.60 m/s 2.70–4.40

Cloud cover37.5 % 33.9–44.3

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis fasciata

At a glance

Sources6 archives

At a glance

Record type2 676 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 676 records