Anasimyia transfuga

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Anasimyia

At a glance

Occurrence records1 485

Data sources6

Biological traits2

DNA specimens13

eDNA detections3

Sources6 archives

Databases and archives Anasimyia transfuga's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 485 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 485 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anasimyia transfuga is a Palearctic species of hoverfly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)saprophagous

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anasimyia transfuga has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes2

eDNA detections3

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.1%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 27 variable positions, in barcode order

22Avariable

50Tvariable

59Tvariable

79Cvariable

106Tvariable

162Tmostly conserved

170Avariable

196Avariable

205Avariable

214Gmostly conserved

250Tvariable

318Cmostly conserved

373Avariable

415Tvariable

430Amostly conserved

445Tvariable

487Tvariable

514Cvariable

541Tvariable

562Tvariable

577Gvariable

604Avariable

613Cvariable

625Avariable

634Cvariable

646Cvariable

658Cmostly conserved

AACTTTATATTTTGTATTTGGAACATGAGCAGGAATAGTAGGTACATCCTTAAGTATATTAATTCGTATAGAACTTGGCCACCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anasimyia anausissame genus3.4%Anasimyia bilinearissame genus3.5%Parhelophilus rexsame family8.5%Parhelophilus frutetorumsame family9.3%Parhelophilus consimilissame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type1 485 records

Wild obs. + sensor1 404

Museum / vouchered81

Range

Area of Occupancy AOO3 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 274≤1 km 127≤10 km 919>10 km 4

1 324 georeferenced · 80 without coordinates

Open the mapobservation + sensor1 404

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 15≤1 km 11≤10 km 18

44 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	18
SLU Artdatabankenlocation not on record	12
University of Tokyo, Department of Zoologylocation not on record	11
Philadelphia, US	5
NHMOlocation not on record	5
Department of Biology and Ecology, Faculty of Sciences, University of Novi Sadlocation not on record	5
Tilburg, NL	5
ZMAAlocation not on record	4
Nijmegen, NL	2
Helsinki, FI	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
CBDClocation not on record	1
BioFokuslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Ugentlocation not on record	1

17 institutions · 78 of 81 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Anasimyia transfuga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 8.00–13.3

Seasonal swing summer↔winter21.7 °C

Max temp (day)11.0 °C 9.90–16.6

Min temp (night)5.80 °C 5.40–9.30

Precipitation36.5 mm/mo 33.9–64.7

Air humidity58.5 % 58.1–58.6

Moisture balance-55.2 mm/mo -55.7–-45.8

Vapour deficit457 Pa 443–651

Wind speed3.10 m/s 2.70–3.10

Cloud cover40.5 % 39.3–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anasimyia transfuga

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 485 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 485 records