Anasimyia anausis

(Walker, 1849) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Anasimyia

At a glance

Occurrence records23

Data sources6

Biological traits0

DNA specimens140

eDNA detections170

Sources6 archives

Databases and archives Anasimyia anausis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI170 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics140 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 2 countries170 detections

DNA & barcodingBOLD140 specimens

01Narrative

Anasimyia anausis (Meigen 1822), the moon-shaped swamp fly, is a fairly common species of syrphid fly observed across North America. Hoverflies can remain nearly motionless in flight. The adults are also known as flower flies for they are commonly found on flowers from which they get both enegy-giving nectar and protein rich pollen. Larvae of this genus are of the rat-tailed type living in aquatic environments.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding140 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anasimyia anausis has left across the world's sequence archives.

At a glance

DNA specimens140

BINs1

Marker genes1

eDNA detections170

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus137 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

196Cmostly conserved

372Gmostly conserved

ACTTTATATTTTGTATTTGGTACATGAGCAGGAATAGTAGGTACATCCCTAAGTATATTAATTCGTATAGAACTTGGTCATCCAGGAGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes6

BIN1

Most divergent pair0.62%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anasimyia bilinearissame genus1.7%Anasimyia transfugasame genus3.4%Anasimyia contractasame genus4.3%Anasimyia diffusasame genus7.3%Parhelophilus rexsame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor14

Museum / vouchered9

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 7≤1 km 2>10 km 1

10 georeferenced · 4 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	6

1 institutions · 6 of 9 vouchered records shown · 3 without an institution code

09Environmental DNA170 detections

Where the DNA of Anasimyia anausis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found170

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 170 detections have coordinates

Open the map2 countries0

ForestUrbanBeachfarmAgricultural fieldagricultural field

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-9.30 °C -9.30–13.3

Seasonal swing summer↔winter36.7 °C

Max temp (day)-5.50 °C -5.50–18.7

Min temp (night)-11.7 °C -11.7–9.00

Precipitation27.5 mm/mo 27.5–89.7

Air humidity72.6 % 55.7–72.6

Moisture balance-7.70 mm/mo -52.2–-7.70

Vapour deficit166 Pa 166–669

Wind speed4.40 m/s 2.30–4.40

Cloud cover61.8 % 41.5–61.8

CHELSA 1981–2010, ~9 km grid, at location & month of 156 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)