Anasimyia bilinearis

(Williston, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Anasimyia

At a glance

Occurrence records376

Data sources7

Biological traits0

DNA specimens20

eDNA detections3

Sources7 archives

Databases and archives Anasimyia bilinearis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF376 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD20 specimens

01Narrative

Anasimyia bilinearis (Williston 1887), the two-lined swamp fly , is an uncommon species of syrphid fly observed throughout North America. Hoverflies can remain nearly motionless in flight. The adults are also known as flower flies for they are commonly found on flowers from which they get both enegy-giving nectar and protein rich pollen. Larvae of this genus are of the rat-tailed type living in aquatic environments.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anasimyia bilinearis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

133Cmostly conserved

136Tmostly conserved

316Gmostly conserved

337Cmostly conserved

373Amostly conserved

407Cmostly conserved

451Amostly conserved

634Tmostly conserved

AACTTTATATTTTGTATTTGGTACATGAGCAGGAATAGTAGGTACATCTCTAAGTATATTAATTCGTATAGAACTTGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes7

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anasimyia anausissame genus1.7%Anasimyia transfugasame genus3.5%Anasimyia contractasame genus4.1%Anasimyia diffusasame genus8.7%Parhelophilus rexsame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type376 records

Wild obs. + sensor368

Museum / vouchered8

Range

Area of Occupancy AOO896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 205≤1 km 78≤10 km 7>10 km 17

307 georeferenced · 61 without coordinates

Open the mapobservation + sensor368

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
University of Western Ontariolocation not on record	3
University of Nebraska State Museumlocation not on record	1

3 institutions · 7 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Anasimyia bilinearis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 10.6–13.4

Seasonal swing summer↔winter30.5 °C

Max temp (day)17.0 °C 14.8–18.6

Min temp (night)7.90 °C 7.10–8.70

Precipitation88.0 mm/mo 82.9–90.5

Air humidity58.4 % 55.9–61.7

Moisture balance-34.7 mm/mo -41.8–-19.5

Vapour deficit607 Pa 494–680

Wind speed3.90 m/s 3.60–4.20

Cloud cover46.7 % 44.7–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)